OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ndufv2 (NM_028388) Mouse Untagged Clone

Be the first to review this product
SKU
MC211367
Ndufv2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ndufv2 or NM_028388"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ndufv2
Synonyms 2900010C23Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211367 representing NM_028388
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCTCCTTGGCGCTGCGGGCCAGGGCGACCGGCCTCGCTGCTCAGTGGGGAAGACATGCAAGGAATT
TGCATAAGACAGCAGTGCACAATGGTGCTGGAGGAGCCTTATTTGTGCATAGAGATACTCCTGAGAATAA
CCCAGATACTCCATTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATAGTAAAAAACTACCCA
GAAGGGCATCAAGCCGCTGCTGTGCTTCCAGTCCTGGATCTCGCCCAAAGGCAGAATGGATGGCTACCTA
TCTCCGCTATGAACAAGGTGGCTGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTT
TTATACAATGTATAATCGAAAGCCAGTTGGGAAGTACCATATCCAGGTCTGCACTACTACACCTTGCATG
CTGCGAGATTCTGACAGCATATTGGAGACCCTTCAGAGAAAGCTTGGAATAAAGGTTGGAGAGACTACAC
CTGACAAACTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTAAATGCACCGATGGTTCAAAT
AAATGACAACTACTATGAGGATCTGACACCCAAGGATATTGAAGAGATTATTGATGAACTCAAAGCTGGA
AAAGTTCCCAAACCAGGGCCAAGGAGTGGCCGCTTCTGTTGTGAGCCAGCTGGAGGCCTTACTTCTTTGA
CTGAACCACCCAAAGGACCTGGCTTTGGTGTGCAAGCAGGCCTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_028388
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_028388.3, NP_082664.1
RefSeq Size 1540 bp
RefSeq ORF 747 bp
Locus ID 72900
UniProt ID Q9D6J6
Cytogenetics 17 E1.1
Summary This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The bovine ortholog of this protein has been characterized and is reported to contain an iron-sulfur cluster, which may be involved in electron transfer. In humans mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Jun 2013
Transcript Variant: This variant (1) encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_028388" in other vectors (4)
SKU Description Size Price
MG203147 Ndufv2 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2) 10 ug
$500.00
MR203147 Ndufv2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein 10 ug
$289.00 $300.00
MR203147L3 Lenti ORF clone of Ndufv2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR203147L4 Lenti ORF clone of Ndufv2 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), nuclear gene encoding mitochondrial protein 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products