Meaf6 (NM_027310) Mouse Untagged Clone

SKU
MC211037
Meaf6 (untagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Meaf6
Synonyms 2310005N01Rik; 2810036M01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211037 representing NM_027310
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGATGCACAACAAGACGGCGCCGCCGCAGATCCCAGACACCCGGCGGGAGCTGGCCGAGCTGGTTA
AGCGGAAGCAGGAGCTGGCGGAAACACTTGCAAACTTGGAGAGACAGATATATGCTTTTGAAGGAAGCTA
CCTGGAAGACACTCAGATGTATGGCAATATTATCCGTGGCTGGGATCGGTATTTGACCAATCAAAAGAAC
TCCAATAGCAAAAACGACCGGAGGAACCGGAAGTTCAAGGAGGCCGAACGGCTCTTCAGCAAATCCTCAG
TCACGTCGGCTGCTGCAGTAAGTGCCTTGGCAGGGGTTCAGGACCAGCTCATCGAAAAGAGGGAACCAGG
AAGTGGGACGGAAAGCGATACTTCTCCAGACTTCCACAATCAGGAAAACGAGCCTGCGCAGGAGGACCCC
GAGGACCTAGACGGCTCCGTCCAGGGAGTGAAACCTCAGAAAGCCGCCTCTTCCACCTCCTCAGGAAGCC
ACCACAGCAGCCACAAAAAACGGAAGAATAAAAACCGGCACAGAATGAATGTCTCCCCCCAAACTGGCTG
GCACCAGCTCCATCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_027310
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027310.4, NP_081586.1
RefSeq Size 1070 bp
RefSeq ORF 579 bp
Locus ID 70088
UniProt ID Q2VPQ9
Cytogenetics 4 D2.2
Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027310" in other vectors (4)
SKU Description Size Price
MG224817 Meaf6 (tGFP-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), (10ug) 10 ug
$500.00
MR224817 Meaf6 (Myc-DDK-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) 10 ug
$289.00 $300.00
MR224817L3 Lenti ORF clone of Meaf6 (Myc-DDK-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) 10 ug
$600.00
MR224817L4 Lenti ORF clone of Meaf6 (mGFP-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products