Cenps (NM_027263) Mouse Untagged Clone

SKU
MC211020
Apitd1 (untagged) - Mouse apoptosis-inducing, TAF9-like domain 1 (Apitd1), (10ug)
  $165.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cenps
Synonyms 2610040C18Rik; 2810407L01Rik; CENP-S
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211020 representing NM_027263
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGGTGGAGGCTGAGGAGCCGCAGGAGTTCTCTCACCGGCAGAGGCTGAAGGCGGCAGTTCACT
ACACGGTCGGCTGTCTCTGCCAGGAAGTCACGCTGAACAAACAGGTGAACTTCAGCAAACAGACCATCGC
GGCGATCTCCGAGGTGACTTTTCGACAGTGCGAAAATTTTGCCAAAGACCTTGAAATGTTTGCCAGACAC
GCGAAAAGAAGCACGGTCACCACTGAAGACGTGAAGCTCTTAGCCAGGCGAAATAATTCACTGCTAAAAT
ACATTACAGAGAAGAATGAAGAGATTGCCCAGCTTAACCTGAAAGGAAAGGCCAAGAAGAAAAGAAAGCC
GGAAGATGAAAGCAGGAGCTCTCGGGAGTCCATGGCTGAGGAGCTGGACGGGGCTGAGGAGCTGCAGAGC
GAGAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_027263
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027263.2, NP_081539.1
RefSeq Size 930 bp
RefSeq ORF 429 bp
Locus ID 69928
UniProt ID Q9D084
Cytogenetics 4 E2
Summary DNA-binding component of the Fanconi anemia (FA) core complex. Required for the normal activation of the FA pathway, leading to monoubiquitination of the FANCI-FANCD2 complex in response to DNA damage, cellular resistance to DNA cross-linking drugs, and prevention of chromosomal breakage. In complex with CENPX (MHF heterodimer), crucial cofactor for FANCM in both binding and ATP-dependent remodeling of DNA. Stabilizes FANCM. In complex with CENPX and FANCM (but not other FANC proteins), rapidly recruited to blocked forks and promotes gene conversion at blocked replication forks. In complex with CENPT, CENPW and CENPX (CENP-T-W-S-X heterotetramer), involved in the formation of a functional kinetochore outer plate, which is essential for kinetochore-microtubule attachment and faithful mitotic progression. As a component of MHF and CENP-T-W-S-X complexes, binds DNA and bends it to form a nucleosome-like structure. DNA-binding function is fulfilled in the presence of CENPX, with the following preference for DNA substates: Holliday junction > double-stranded > splay arm > single-stranded. Does not bind DNA on its own.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027263" in other vectors (4)
SKU Description Size Price
MG221175 Apitd1 (tGFP-tagged) - Mouse apoptosis-inducing TAF9-like domain 1 (Apitd1), (10ug) 10 ug
$350.00
MR221175 Apitd1 (Myc-DDK-tagged) - Mouse apoptosis-inducing, TAF9-like domain 1 (Apitd1) 10 ug
$289.00
MR221175L3 Lenti ORF clone of Apitd1 (Myc-DDK-tagged) - Mouse apoptosis-inducing, TAF9-like domain 1 (Apitd1) 10 ug
$450.00
MR221175L4 Lenti ORF clone of Apitd1 (mGFP-tagged) - Mouse apoptosis-inducing, TAF9-like domain 1 (Apitd1) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products