Chmp2b (NM_026879) Mouse Untagged Clone

SKU
MC210823
Chmp2b (untagged) - Mouse chromatin modifying protein 2B (Chmp2b), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Chmp2b
Synonyms 1190006E07Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210823 representing NM_026879
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTCCCTCTTCAAGAAGAAGACTGTGGACGATGTCATAAAGGAACAGAATCGAGAGCTGCGTGGCA
CCCAGAGGGCCATCATCAGGGACCGAGCAGCCTTAGAGAAACAGGAGAAACAGCTGGAGTTAGAAATTAA
GAAGATGGCCAAGATTGGTAATAAGGAAGCGTGCAGGGTTTTAGCTAAGCAGCTTGTCCACCTACGGAAA
CAGAAGACAAGAACGTTCGCTGTAAGCTCAAAAGTCACCTCTATGTCCACACAAACGAAAGTGATGAATT
CCCAGATGAAGATGGCCGGTGCCATGTCTACCACTGCAAAGACAATGCAAGCAGTCAACAAGAAAATGGA
TCCACAGAAGACACTACAAACAATGCAGAATTTCCAGAAGGAAAACATGAAAATGGAAATGACTGAAGAA
ATGATCAATGACACCCTGGATGACATCTTTGATGGCTCTGATGATGAAGAAGAAAGCCAGGACATCGTGA
ATCAAGTTCTTGATGAAATTGGGATTGAAATCTCTGGAAAGATGGCCAAAGCTCCATCGGCTGCAAGAAG
CTTACCGTCTGCCTCCACTTCAAAGGCTACAATTTCTGATGAAGAGATTGAACGTCAACTCAAAGCTTTA
GGGGTAGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_026879
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_026879.2, NP_081155.1
RefSeq Size 1838 bp
RefSeq ORF 642 bp
Locus ID 68942
UniProt ID Q8BJF9
Cytogenetics 16 C1.3
Summary Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis. ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4 (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_026879" in other vectors (4)
SKU Description Size Price
MG202330 Chmp2b (tGFP-tagged) - Mouse chromatin modifying protein 2B (Chmp2b) 10 ug
$500.00
MR202330 Chmp2b (Myc-DDK-tagged) - Mouse chromatin modifying protein 2B (Chmp2b) 10 ug
$289.00 $300.00
MR202330L3 Lenti ORF clone of Chmp2b (Myc-DDK-tagged) - Mouse chromatin modifying protein 2B (Chmp2b) 10 ug
$600.00
MR202330L4 Lenti ORF clone of Chmp2b (mGFP-tagged) - Mouse chromatin modifying protein 2B (Chmp2b) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products