OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Commd4 (NM_025417) Mouse Untagged Clone

Be the first to review this product
SKU
MC210300
Commd4 (untagged) - Mouse COMM domain containing 4 (Commd4), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Commd4 or NM_025417"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Commd4
Synonyms 1110039H05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210300 representing NM_025417
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGTTCCGGTTCTGTGGCGATCTGGACTGTCCCGACTGGGTCCTGGCAGAGATCAGCACACTGGCCA
AAATTTCCTCTGTGAAGCTGCGACTGCTGTGTAGCCAGGTGCTAAAGGAGCTTCTGGGTCAGGGGATTGA
TTATGAGAAGATCTTGAAGCTTACTGCTGATGCCAAGTTTGAGTCTGGAGACGTGAAGGCCACGGTCGCG
GTGCTGAGTTTCATCCTGTCCAGTGCAGCCAAGCATAGTGTCGACAGTGATTCCTTGTCCAGTGAGCTGC
AGCAGCTGGGGCTGCCCAAAGAGCATGCCACCAGCCTGTGCCGCTGTTACGAAGAGAAGCAGAGCCCCCT
GCAGGAGCACCTTCGGGCCTGTAGCCTACGTGTGAACAGGCTGGCCAGCGTGGGCTGGCGGGTAGACTAC
ACCCTGAGCTCCAGCCTGCTTCATTCTGTGGAGGAGCCCATGGTACATCTGCAGCTACAGGTTGTGCCTG
CTCCAGGTACCCAGGCCCAACCTGTTTCCATGTCCCTCTCGGCAGACAAGTTCCAGGTTCTCCTGGCAGA
ACTGAAGCAAGCCCAGACCATGATGACTGCTTTGGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_025417
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025417.2, NP_079693.1
RefSeq Size 824 bp
RefSeq ORF 600 bp
Locus ID 66199
UniProt ID Q9CQ02
Cytogenetics 9 B
Summary May modulate activity of cullin-RING E3 ubiquitin ligase (CRL) complexes. Down-regulates activation of NF-kappa-B.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025417" in other vectors (4)
SKU Description Size Price
MG201996 Commd4 (tGFP-tagged) - Mouse COMM domain containing 4 (Commd4) 10 ug
$500.00
MR201996 Commd4 (Myc-DDK-tagged) - Mouse COMM domain containing 4 (Commd4) 10 ug
$289.00 $300.00
MR201996L3 Lenti ORF clone of Commd4 (Myc-DDK-tagged) - Mouse COMM domain containing 4 (Commd4) 10 ug
$600.00
MR201996L4 Lenti ORF clone of Commd4 (mGFP-tagged) - Mouse COMM domain containing 4 (Commd4) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products