OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Acer3 (NM_025408) Mouse Untagged Clone

Be the first to review this product
SKU
MC210295
Acer3 (untagged) - Mouse alkaline ceramidase 3 (Acer3), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Acer3 or NM_025408"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Acer3
Synonyms 1110057L18Rik; 5430429L08Rik; AV015045; Phca
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210295 representing NM_025408
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCCGGCTGTGGACCGCAAAGGCTATTGGGGCCCCACGACCTCCACATTGGACTGGTGTGAGGAGA
ACTATGTGGTGACCTTGTTCGTCGCTGAGTTCTGGAATACAGTGAGTAACCTGATTATGATCATACCTCC
AATTTTTGGTGCAATTCAAGGCATTAGAGACAGACTGGAGAAGCGGTACATTGCTGCTTACTTAGCACTC
ACAGTGGTAGGAATGGGATCCTGGTGTTTCCACATGACTCTGAAATATGAAATGCAGCTGTTGGATGAGC
TCCCCATGATTTACAGCTGCTGCATATTTGTATACTGCATGTTTGAGTGTTTCAAGACAAAGAGCTCAAT
AAACTACCATCTTCTTTTTACCCTATTTCTATACAGTTTAACAGTAACTACGATTTACCTAAAAGTCAAA
GAACCTATATTCCATCAGGTCATGTATGGAATGTTGGTCTTTACATTAGTACTTCGTTCTATTTATATTG
TTACATGGGTTTATCCATGGCTTAGAGGACTAGGTTATACATCCTTAACTGTCTTTTTATTGGGGTTTTT
ATTGTGGAATATAGATAACATCTTTTGTGATTCACTGAGGAACTTTCGAAAGAGAGTGCCCCCCGTCCTA
GGTGTTACAACACAGTTTCATGCATGGTGGCATATTCTAACTGGCCTGGGTTCTTATCTTCACATCCTTT
TCAGTTTATATACAAGAACACTTTACCTGAGGTACAGGCCAAAAGTGAAGTTTCTCTTTGGAATCTGGCC
AGCAGTCATGTTTGAACCTCAGAGGAAGCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_025408
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025408.2, NP_079684.2
RefSeq Size 4058 bp
RefSeq ORF 804 bp
Locus ID 66190
UniProt ID Q9D099
Cytogenetics 7 E1
Summary Endoplasmic reticulum and Golgi ceramidase that catalyzes the hydrolysis of unsaturated long-chain C18:1-, C20:1- and C20:4-ceramides, dihydroceramides and phytoceramides into sphingoid bases like sphingosine and free fatty acids at alkaline pH (PubMed:26474409). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:26474409). Controls the generation of sphingosine in erythrocytes, and thereby sphingosine-1-phosphate in plasma (By similarity). Through the regulation of ceramides and sphingosine-1-phosphate homeostasis in the brain may play a role in neurons survival and function (PubMed:26474409). By regulating the levels of proinflammatory ceramides in immune cells and tissues, may modulate the inflammatory response (PubMed:26938296).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025408" in other vectors (4)
SKU Description Size Price
MG218055 Acer3 (tGFP-tagged) - Mouse alkaline ceramidase 3 (Acer3), (10ug) 10 ug
$500.00
MR218055 Acer3 (Myc-DDK-tagged) - Mouse alkaline ceramidase 3 (Acer3) 10 ug
$289.00 $300.00
MR218055L3 Lenti ORF clone of Acer3 (Myc-DDK-tagged) - Mouse alkaline ceramidase 3 (Acer3) 10 ug
$600.00
MR218055L4 Lenti ORF clone of Acer3 (mGFP-tagged) - Mouse alkaline ceramidase 3 (Acer3) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products