OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rnf138 (NM_019706) Mouse Untagged Clone

Be the first to review this product
SKU
MC210067
Rnf138 (untagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rnf138 or NM_019706"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rnf138
Synonyms 2410015A17Rik; 2810480D20Rik; STRIN; Trif; Trif-d
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210067 representing NM_019706
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGAGGAACTTTCGGCGGCCACGTCCTACACGGAAGATGATTTCTACTGCCCTGTCTGTCAGGAGG
TGCTCAAGACGCCGGTGCGGACCGCGGCCTGTCAGCACGTTTTCTGTAGAAAATGTTTCCTGACTGCAAT
GAGAGAAAGTGGAATACATTGTCCCCTATGTCGTGGAAGTGTGACTAGAAGAGAAAGAGCATGTCCGGAA
CGGGCCTTAGATCTTGAAAATATCATGAGGAGGTTTTCTGGTAGCTGCAGATGCTGTTCAAAAAAGATTA
AATTCTATCGCATGAGACATCATTACAAATCTTGTAAGAAGTATCAGGATGAATATGGTGTTTCTTCTGT
CATTCCAAACTTTAAGATTTCTCAAGATTCAGTAAGGAGCAGTAATAGGAGTGAAACATCTGCATCTGAT
AACACAGAAACTTATCAAGAGGATACAAGTTCTTCTGGGCATCCTACCTTTAAGTGTCCCTTATGTCAAG
AGTCAAATTTCACCAGACAACGTTTATTGGATCACTGTAATAGTAACCACCTATTTCAGATAGTTCCTGT
GAATCTTCAGCTAGATGAGGAAACCCAATATCAAACTGCTGTGGAAGAGTCTTTTCAAGTAAACATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_019706
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019706.3, NP_062680.2
RefSeq Size 3044 bp
RefSeq ORF 630 bp
Locus ID 56515
UniProt ID Q9CQE0
Cytogenetics 18 A2
Summary E3 ubiquitin-protein ligase involved in DNA damage response by promoting DNA resection and homologous recombination. Recruited to sites of double-strand breaks following DNA damage and specifically promotes double-strand break repair via homologous recombination. Two different, non-exclusive, mechanisms have been proposed. According to a report, regulates the choice of double-strand break repair by favoring homologous recombination over non-homologous end joining (NHEJ): acts by mediating ubiquitination of XRCC5/Ku80, leading to remove the Ku complex from DNA breaks, thereby promoting homologous recombination. According to another report, cooperates with UBE2Ds E2 ubiquitin ligases (UBE2D1, UBE2D2, UBE2D3 or UBE2D4) to promote homologous recombination by mediating ubiquitination of RBBP8/CtIP. Together with NLK, involved in the ubiquitination and degradation of TCF/LEF. Also exhibits auto-ubiquitination activity in combination with UBE2K. May act as a negative regulator in the Wnt/beta-catenin-mediated signaling pathway.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019706" in other vectors (4)
SKU Description Size Price
MG202240 Rnf138 (tGFP-tagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 2 10 ug
$500.00
MR202240 Rnf138 (Myc-DDK-tagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 2 10 ug
$289.00 $300.00
MR202240L3 Lenti ORF clone of Rnf138 (Myc-DDK-tagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 2 10 ug
$600.00
MR202240L4 Lenti ORF clone of Rnf138 (mGFP-tagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products