OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Abcc5 (NM_176839) Mouse Untagged Clone

Be the first to review this product
SKU
MC209798
Abcc5 (untagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Abcc5 or NM_176839"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Abcc5
Synonyms 2900011L11Rik; Abcc; Abcc5a; Abcc5b; AI132311; Mr; Mrp5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209798 representing NM_176839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGATATTGACATGGGAAAAGAATATATCATCCCCAGCCCTGGGTACAGAAGTGACAGGGACAGAA
GCGCTGTACCAGGGCAACACAGAGACCCCGAGGAACCCAGGTTCCGGAGAACAAGATCGTTGGAATGCCA
AGATGCTCTCGAAACAGCAGCCCGAGTTGAGGGGCTTTCCCTGGATATCTCTGTGCATTCTCATCTCCAA
ATTCTGGACGAGGAGCATTCTAAGGGAAAATACCACCATGGTTTAAGTGTCCTGAAGCCCTTCCGGACCA
CTACCAAGCACCAGCACCCAGTGGACAATGCTGGACTTTTCTCCTACATGACCTTTTCATGGCTCTCTCC
TCTGGCCCGAGTGGTTCACAAGAAGGGGGAGCTGTTAATGGAGGATGTGTGGCCTTTGTCCAAGTATGAG
TCTTCTGATGTGAACAGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACG
CTGCCTCCCTGCGAAGGGTTGTGTGGATCTTTTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGAT
GATCACGCAGTTGGCTGGCTTCAGTGGACCAAATTTTCAGGATGGCTGTATTCTGCGGTCAGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_176839
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_176839.1, NP_789809.1
RefSeq Size 1204 bp
RefSeq ORF 627 bp
Locus ID 27416
Cytogenetics 16 12.41 cM
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) lacks multiple 3' exons but has two alternate 3' exons, as compared to variant 1. The encoded isoform (2) is much shorter and has a distinct C-terminus, as compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_176839" in other vectors (4)
SKU Description Size Price
MG218235 Abcc5 (tGFP-tagged) - Mouse ATP-binding cassette sub-family C (CFTR/MRP) member 5 (Abcc5) transcript variant 2, (10ug) 10 ug
$500.00
MR218235 Abcc5 (Myc-DDK-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 10 ug
$289.00 $300.00
MR218235L3 Lenti ORF clone of Abcc5 (Myc-DDK-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 10 ug
$600.00
MR218235L4 Lenti ORF clone of Abcc5 (mGFP-tagged) - Mouse ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products