Rcn2 (NM_011992) Mouse Untagged Clone

SKU
MC209742
Rcn2 (untagged) - Mouse reticulocalbin 2 (Rcn2), (10ug)
  $330.00
4 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rcn2
Synonyms AA408742; Tcbp49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209742 representing NM_011992
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGCTGGGCCCAAGGCCCGCGGCGCTAGGACTGCTGCTGCCGCTGCTGCTGTACGCCGCGGTGGCTG
GCGCCAGCAAGGCGGAGGAACTGCACTACCCGCAGGGCGAGCACCGGGCGGACTACGACCGCGAAGCGCT
GCTGGGTGTCCAGGAAGACGTCGATGAGTATGTTAAACTTGGCCACGAAGAGCAGCAAAGACGATTGCAG
TCGATCATAAAGAAAATTGACTCGGACTCTGATGGCTTTCTTACTGAAAATGAACTCAGTCAGTGGATTC
AGATGTCTTTTAAGCATTACGCTATGCAAGAAGCCAAGCAGCAGTTTGTGGAGTATGATAAGAACAGCGA
CGGCGCTGTGACGTGGGATGAGTACAACATCCAGATGTACGACCGGGTGATTGACTTTGATGAGAACACT
GCTCTGGATGACACAGAAGAGGGGTCGTTCAGGCAGCTTCATCTAAAGGATAAGAAGCGATTTGAAAAAG
CTAACCAGGATTCAGGTCCTGGTCTGAGTCTTGAAGAGTTCATTGCGTTTGAGCACCCTGAAGAAGTTGA
CTATATGACGGAGTTCGTCATCCAAGAGGCTTTGGAAGAACATGACAAAAATGGCGATGGGTTTGTTAGT
TTGGAAGAATTTCTTGGCGATTACAGGCGGGATCCAACTGCAAATGAAGACCCAGAATGGATACTTGTTG
AAAAGGACAGATTTGTGAATGATTATGACAAAGATAATGATGGCCGGCTTGATCCCCAAGAGCTGTTGTC
ATGGGTAGTGCCCAATAACCAGGGCATTGCACAAGAGGAAGCTCTTCATCTGATTGATGAGATGGATTTG
AATAGTGACAAAAAGCTCTCTGAAGAAGAGATTCTGGAAAACCAAGACTTGTTCCTTACCAGCGAAGCCA
CGGATTATGGCCGACAGCTCCATGACGACTACTTCTATCATGACGAGCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011992
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011992.2, NP_036122.2
RefSeq Size 2042 bp
RefSeq ORF 963 bp
Locus ID 26611
UniProt ID Q8BP92
Cytogenetics 9 B
Summary Not known. Binds calcium (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: This CCDS representation uses a downstream start codon that is well-conserved in mammalian organisms. It also contains an upstream in-frame start codon that would result in a 35 aa N-terminal extension. However, this upstream start codon is only present in mouse and rat, and its use would eliminate an N-terminal signal peptide that is only predicted in the shorter N-terminus. N-terminal sequencing of the rat protein in PMID:7722520 indicates signal peptide cleavage. It is likely that the upstream start codon is skipped due to leaky scanning by ribosomes, thereby permitting translation initiation at the currently represented start codon.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011992" in other vectors (4)
SKU Description Size Price
MG224605 Rcn2 (tGFP-tagged) - Mouse reticulocalbin 2 (Rcn2), (10ug) 10 ug
$489.00 $500.00
MR224605 Rcn2 (Myc-DDK-tagged) - Mouse reticulocalbin 2 (Rcn2) 10 ug
$289.00 $300.00
MR224605L3 Lenti ORF clone of Rcn2 (Myc-DDK-tagged) - Mouse reticulocalbin 2 (Rcn2) 10 ug
$600.00
MR224605L4 Lenti ORF clone of Rcn2 (mGFP-tagged) - Mouse reticulocalbin 2 (Rcn2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products