OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tfdp1 (NM_009361) Mouse Untagged Clone

Be the first to review this product
SKU
MC209518
Tfdp1 (untagged) - Mouse transcription factor Dp 1 (Tfdp1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA343658 Rabbit Polyclonal Anti-Tfdp1 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tfdp1 or NM_009361"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tfdp1
Synonyms Dp1; Drtf1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209518 representing NM_009361
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAAAAGATGCCAGTCTAATTGAAGCCAACGGAGAACTAAAGGTCTTTATAGACCAGAATCTTAGTC
CTGGGAAAGGTGTGGTATCTCTTGTAGCCGTCCACCCGTCCACAGTCAACACACTTGGGAAGCAGCTTTT
GCCAAAAACCTTCGGACAGTCCAATGTCAATATCACACAGCAAGTGGTGATTGGCACGCCTCAGAGACCG
GCAGCATCCAACACTATTGTGGTAGGAAGCCCACACACTCCCAACACGCATTTTGTGTCACAGAACCAGA
CGTCTGACTCCTCACCTTGGTCTGCTGGGAAGCGGAACAGGAAGGGCGAGAAGAATGGCAAGGGCCTGCG
GCATTTCTCCATGAAGGTGTGTGAGAAGGTGCAGAGGAAAGGAACCACCTCCTACAATGAGGTGGCTGAC
GAGCTGGTGGCAGAGTTCAGCGCTGCCGACAACCACATTCTACCAAACGAATCAGCTTATGACCAGAAGA
ACATCCGGCGGCGTGTCTACGATGCCTTAAATGTGCTAATGGCCATGAACATCATCTCCAAGGAGAAGAA
GGAGATCAAATGGATCGGCCTGCCCACCAACTCAGCTCAGGAGTGCCAGAACTTAGAGGTAGAGAGGCAG
AGGAGGCTGGAGAGGATCAAACAGAAGCAGTCACAGCTCCAGGAGCTCATCCTGCAGCAAATTGCCTTCA
AGAACTTGGTGCAGAGAAATCGCCAAGCTGAGCAGCAGGCCCGCAGGCCGCCTCCTCCCAACTCTGTCAT
CCACTTGCCCTTCATCATTGTCAACACCAGCAGGAAGACAGTCATTGACTGCAGCATCTCCAATGACAAA
TTTGAGTATCTGTTTAACTTTGACAACACGTTTGAGATCCACGATGACATTGAGGTGCTCAAGCGCATGG
GCATGGCATGTGGGCTGGAGTCTGGCAACTGCTCTGCTGAAGACCTCAAGGTGGCCAGAAGTTTGGTACC
AAAAGCTCTAGAACCATACGTGACAGAAATGGCTCAGGGATCCATTGGTGGAGTATTCGTCACGACAACA
GGTTCTACATCCAATGGCACAAGGCTTTCTGCCAGTGATTTGAGCAATGGTGCAGATGGGATGCTGGCCA
CGAGCTCCAATGGGTCTCAGTACAGCGGCTCCAGGGTCGAGACCCCTGTGTCCTACGTTGGGGAGGATGA
TGACGACGATGATGACTTTAATGAGAACGACGAGGAGGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_009361
Insert Size 1233 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009361.3, NP_033387.1
RefSeq Size 2584 bp
RefSeq ORF 1233 bp
Locus ID 21781
UniProt ID Q08639
Cytogenetics 8 A1.1
Summary Can stimulate E2F-dependent transcription. Binds DNA cooperatively with E2F family members through the E2 recognition site, 5'-TTTCCGCGC-3', found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The E2F1:DP complex appears to mediate both cell proliferation and apoptosis. Blocks adipocyte differentiation by repressing CEBPA binding to its target gene promoters (PubMed:20176812).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009361" in other vectors (4)
SKU Description Size Price
MG221670 Tfdp1 (tGFP-tagged) - Mouse transcription factor Dp 1 (Tfdp1), (10ug) 10 ug
$657.00
MR221670 Tfdp1 (Myc-DDK-tagged) - Mouse transcription factor Dp 1 (Tfdp1) 10 ug
$289.00 $457.00
MR221670L3 Lenti ORF clone of Tfdp1 (Myc-DDK-tagged) - Mouse transcription factor Dp 1 (Tfdp1) 10 ug
$757.00
MR221670L4 Lenti ORF clone of Tfdp1 (mGFP-tagged) - Mouse transcription factor Dp 1 (Tfdp1) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products