Supt4a (NM_009296) Mouse Untagged Clone

SKU
MC209480
Supt4a (untagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Supt4a
Synonyms AL022777; Supt4h; Supt4h1; Supt4h1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209480 representing NM_009296
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTGGAGACGGTACCAAAGGACCTGCGGCATCTGCGGGCTTGTTTGCTGTGCTCGTTAGTCAAGA
CTATAGACCAGTTCGAATATGATGGGTGTGACAATTGCGATGCATACCTACAAATGAAGGGCAACAGAGA
GATGGTTTATGACTGCACCAGCTCTTCATTTGATGGAATCATTGCGATGATGAGTCCAGAGGACAGCTGG
GTCTCCAAGTGGCAGCGAGTCAGTAACTTTAAGCCAGGTGTATATGCTGTGTCCGTCACTGGTCGCCTGC
CCCAAGGAATCGTGCGGGAGCTGAAAAGTCGAGGAGTGGCCTACAAATCCAGAGACACAGCAATAAAGAC
CTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_009296
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009296.1, NP_033322.1
RefSeq Size 693 bp
RefSeq ORF 354 bp
Locus ID 20922
UniProt ID P63271
Cytogenetics 11 52.2 cM
Summary Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009296" in other vectors (4)
SKU Description Size Price
MG200506 Supt4a (tGFP-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) 10 ug
$489.00
MR200506 Supt4a (Myc-DDK-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) 10 ug
$289.00
MR200506L3 Lenti ORF clone of Supt4a (Myc-DDK-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) 10 ug
$450.00
MR200506L4 Lenti ORF clone of Supt4a (mGFP-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products