OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Six2 (NM_011380) Mouse Untagged Clone

Be the first to review this product
SKU
MC209406
Six2 (untagged) - Mouse sine oculis-related homeobox 2 homolog (Drosophila) (Six2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Six2 or NM_011380"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Six2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209406 representing NM_011380
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCATGCTGCCCACCTTCGGCTTCACGCAGGAGCAAGTGGCGTGCGTGTGCGAGGTGCTGCAGCAGG
GCGGCAACATCGAGCGGCTGGGTCGCTTCCTGTGGTCGCTGCCCGCCTGCGAGCACCTCCACAAGAATGA
AAGCGTGCTCAAGGCCAAGGCCGTGGTGGCCTTCCACCGGGGCAACTTCCGCGAGCTCTACAAAATCCTG
GAGAGCCACCAGTTCTCGCCGCACAACCACGCCAAGCTGCAGCAGTTGTGGCTCAAGGCGCACTACATCG
AGGCGGAGAAGCTGCGCGGCCGGCCGCTGGGCGCCGTGGGCAAGTACCGCGTGCGGCGCAAGTTCCCGCT
GCCCCGCTCCATCTGGGACGGCGAGGAGACCAGCTACTGCTTCAAGGAGAAGAGCCGCAGCGTGCTGCGC
GAGTGGTACGCTCACAACCCCTACCCGTCGCCACGAGAGAAGCGCGAGCTGGCCGAGGCCACCGGCCTCA
CCACCACGCAAGTCAGCAACTGGTTCAAGAACCGGCGGCAGCGCGACAGGGCGGCCGAGGCCAAGGAAAG
GGAGAACAGCGAGAACTCCAATTCCAGCAGCCACAACCCGCTGGCTTCCTCGCTCAATGGCAGTGGCAAG
TCGGTGCTAGGCAGTTCCGAGGATGAGAAGACGCCGTCGGGGACTCCAGACCACTCGTCGTCCAGTCCCG
CTCTGTTGCTCAGCCCGCCGCCGCCCCCTGGGCTGCCTTCCCTGCACAGCCTGGGCCACCCTCCGGGCCC
GAGCGCAGTACCCGTACCAGTGCCCGGTGGAGGCGGCGCGGACCCACTGCAGCATCACCACAGCCTGCAG
GACTCCATACTCAACCCCATGTCGGCCAACCTTGTGGACCTGGGCTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011380
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011380.2, NP_035510.1
RefSeq Size 2108 bp
RefSeq ORF 891 bp
Locus ID 20472
UniProt ID Q62232
Cytogenetics 17 55.72 cM
Summary Transcription factor that plays an important role in the development of several organs, including kidney, skull and stomach. During kidney development, maintains cap mesenchyme multipotent nephron progenitor cells in an undifferentiated state by opposing the inductive signals emanating from the ureteric bud and cooperates with WNT9B to promote renewing progenitor cells proliferation. Acts through its interaction with TCF7L2 and OSR1 in a canonical Wnt signaling independent manner preventing transcription of differentiation genes in cap mesenchyme such as WNT4. Also acts independently of OSR1 to activate expression of many cap mesenchyme genes, including itself, GDNF and OSR1. During craniofacial development plays a role in growth and elongation of the cranial base through regulation of chondrocyte differentiation (PubMed:20515681). During stomach organogenesis, controls pyloric sphincter formation and mucosal growth through regulation of a gene network including NKX2-5, BMPR1B, BMP4, SOX9 and GREM1 (PubMed:19660448). During branchial arch development, acts to mediate HOXA2 control over the insulin-like growth factor pathway (PubMed:18321982). Also may be involved in limb tendon and ligament development (PubMed:7720577). Plays a role in cell proliferation and migration (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011380" in other vectors (4)
SKU Description Size Price
MG204100 Six2 (tGFP-tagged) - Mouse sine oculis-related homeobox 2 homolog (Drosophila) (Six2) 10 ug
$489.00 $500.00
MR204100 Six2 (Myc-DDK-tagged) - Mouse sine oculis-related homeobox 2 homolog (Drosophila) (Six2) 10 ug
$289.00 $300.00
MR204100L3 Lenti ORF clone of Six2 (Myc-DDK-tagged) - Mouse sine oculis-related homeobox 2 homolog (Drosophila) (Six2) 10 ug
$600.00
MR204100L4 Lenti ORF clone of Six2 (mGFP-tagged) - Mouse sine oculis-related homeobox 2 homolog (Drosophila) (Six2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products