Sct (NM_011328) Mouse Untagged Clone

SKU
MC209359
Sct (untagged) - Mouse secretin (Sct), (10ug)
  $240.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sct
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209359 representing NM_011328
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCTCCGCTGCCCACGCCGATGCTACTGCTGTTGCTGCTGCTGCTCTCCAGTTCCGCCGCGCTCC
CTGCACCTCCCAGGACCCCAAGACACTCAGACGGAATGTTCACCAGCGAGCTCAGCCGCTTGCAGGACAG
TGCCAGGCTGCAGCGCCTGCTGCAGGGTCTGGTGGGGAAGCGCAGCGAGCAGGACACAGAAAATATCCCA
GAGAACAGCCTGGCCCGGTCCAAGCCCTTAGAGGACCAGCTCTGCTTGCTGTGGTCGAACACTCAGACCC
TACAGGACTGGCTTCTGCCCAGGCTGTCCCTGGATGGGTCCCTGTCTCTCTGGCTGCCTCCTGGACCAAG
GTCTGCTGTTGATCGTTCAGAGTGGACTGAAACAACCAGGCCACCCAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011328
Insert Size 402 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011328.3, NP_035458.1
RefSeq Size 518 bp
RefSeq ORF 402 bp
Locus ID 20287
UniProt ID Q08535
Cytogenetics 7 F5
Summary This gene encodes the precursor of a gastrointestinal peptide hormone of the secretin-glucagon family. The encoded protein is secreted as a prohormone that undergoes proteolytic processing to generate a mature peptide hormone. The mature peptide regulates secretion of gastric acid, biocarbonate ions from pancreatic and biliary duct epithelia and water homeostasis in the gastrointestinal system. Mice lacking the encoded protein display decreased survival of neuroprogenitor cells during early postnatal period and impaired long-term potentiation and spatial learning in adulthood. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may be processed in a similar manner to generate the mature peptide hormone. provided by RefSeq, Jul 2015
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. It encodes a shorter protein (isoform 2), compared to isoform 1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011328" in other vectors (4)
SKU Description Size Price
MG226326 Sct (tGFP-tagged) - Mouse secretin (Sct), (10ug) 10 ug
$425.00
MR226326 Sct (Myc-DDK-tagged) - Mouse secretin (Sct) 10 ug
$225.00
MR226326L3 Lenti ORF clone of Sct (Myc-DDK-tagged) - Mouse secretin (Sct) 10 ug
$525.00
MR226326L4 Lenti ORF clone of Sct (mGFP-tagged) - Mouse secretin (Sct) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products