OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Nr1i2 (NM_010936) Mouse Untagged Clone

Be the first to review this product
SKU
MC209057
Nr1i2 (untagged) - Mouse nuclear receptor subfamily 1, group I, member 2 (Nr1i2), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Nr1i2 or NM_010936"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nr1i2
Synonyms mPXR; PXR; PXR.1; PXR.2; PXR1; SXR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209057 representing NM_010936
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGACCTGAGGAGAGCTGGAGCCGAGTTGGCCTTGTACAGTGTGAAGAAGCAGACTCTGCCTTGGAAG
AGCCCATCAACGTAGAGGAGGAAGATGGAGGTCTTCAAATCTGCCGTGTATGTGGGGACAAGGCCAATGG
CTACCACTTCAATGTCATGACGTGTGAAGGATGCAAGGGGTTTTTCAGAAGGGCCATGAAACGCAATGTC
CGGCTGAGGTGCCCCTTCCGCAAGGGAACCTGCGAGATCACCCGGAAGACACGACGGCAGTGCCAGGCCT
GCCGTTTGCGCAAGTGCCTGGAGAGTGGCATGAAGAAAGAGATGATCATGTCCGATGCCGCTGTGGAGCA
GAGGCGGGCCTTGATCAAGAGGAAGAAGAGGGAAAAGATTGAGGCTCCACCGCCTGGAGGGCAGGGGCTG
ACGGAAGAACAGCAGGCGCTGATCCAGGAGCTGATGGACGCTCAGATGCAAACCTTTGACACAACTTTCT
CCCACTTCAAGGATTTCCGGCTGCCTGCAGTGTTCCACAGTGGCTGTGAGCTTCCAGAGTTTCTGCAGGC
CTCACTGTTGGAAGACCCTGCCACATGGAGTCAAATCATGAAAGACAGGGTTCCAATGAAGATCTCTCTG
CAGCTGCGCGGAGAAGACGGCAGCATCTGGAACTACCAACCCCCTTCCAAGAGCGACGGGAAAGAGATCA
TCCCTCTTCTGCCACACCTGGCCGATGTGTCAACCTACATGTTCAAGGGCGTCATCAACTTCGCCAAAGT
CATATCCTACTTTAGGGACCTGCCTATTGAGGACCAGATCTCCCTGCTGAAGGGGGCCACTTTTGAGATG
TGCATCCTGAGGTTCAACACGATGTTCGACACGGAAACGGGAACCTGGGAGTGCGGCCGGCTGGCTTACT
GCTTCGAAGACCCTAATGGTGGCTTCCAGAAACTTCTGTTGGATCCATTGATGAAATTCCACTGCATGCT
GAAGAAGCTACAGCTGCATAAGGAGGAGTATGTGCTGATGCAGGCCATCTCCCTCTTCTCCCCAGATCGT
CCTGGTGTGGTCCAGCGCAGCGTGGTAGACCAACTGCAGGAGAGGTTTGCCCTCACCCTGAAGGCCTACA
TTGAGTGTAGTCGGCCATATCCTGCTCACAGGTTCCTGTTCCTGAAGATCATGGCCGTCCTCACTGAGCT
GCGAAGCATCAACGCCCAGCAAACCCAGCAGTTGCTGCGCATCCAAGACTCGCACCCCTTTGCCACCCCA
CTCATGCAAGAGTTATTTAGCAGCACAGATGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_010936
Insert Size 1296 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC120796, AAI20797
RefSeq Size 1565 bp
RefSeq ORF 1296 bp
Locus ID 18171
UniProt ID O54915
Cytogenetics 16 B3
Summary Nuclear receptor that binds and is activated by a variety of endogenous and xenobiotic compounds. Transcription factor that activates the transcription of multiple genes involved in the metabolism and secretion of potentially harmful xenobiotics, endogenous compounds and drugs. Response to specific ligands is species-specific, due to differences in the ligand-binding domain. Binds to a response element in the promoters of the CYP3A4 and ABCB1/MDR1 genes (By similarity). Activated by naturally occurring steroids such as pregnenolone and progesterone, the cholesterol metabolite 5-beta-cholestane-3-alpha,7-alpha,12-alpha-triol, synthetic glucocorticoids and antiglucocorticoids and 16-alpha-carbonitrile (PCN).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (1, also known as PXR.1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010936" in other vectors (4)
SKU Description Size Price
MG226044 Nr1i2 (tGFP-tagged) - Mouse nuclear receptor subfamily 1 group I member 2 (Nr1i2) transcript variant 1, (10ug) 10 ug
$886.00
MR226044 Nr1i2 (Myc-DDK-tagged) - Mouse nuclear receptor subfamily 1, group I, member 2 (Nr1i2), transcript variant 1 10 ug
$686.00
MR226044L3 Lenti ORF clone of Nr1i2 (Myc-DDK-tagged) - Mouse nuclear receptor subfamily 1, group I, member 2 (Nr1i2), transcript variant 1 10 ug
$986.00
MR226044L4 Lenti ORF clone of Nr1i2 (mGFP-tagged) - Mouse nuclear receptor subfamily 1, group I, member 2 (Nr1i2), transcript variant 1 10 ug
$986.00

file-alt Citations

3-Hydroxyflavone and structural analogues differentially activate pregnane X receptor: Implication for inflammatory bowel disease
Lau, Chang
Pharmacol. Res. (2015) 100, 64-72 DOI: 10.1016/j.phrs.2015.07.031
Cited by 28
AI Summary: OriGene products, specifically the plasmids pCMV6-entry-mPXR, pCMV6-entry-rPXR, pCMV6-XL4-hPXR, pCMV6-entry, and pCMV6-XL4, were used to express mouse, rat, and human pregnane X receptors in cell-based assays to investigate the activation of PXR by 3-hydroxyflavone and its analogues.
Snippet: 2.2. Plasmids. pCMV6-entry-mPXR, pCMV6-entry-rPXR, pCMV6-XL4-hPXR, pCMV6-entry, and pCMV6-XL4 were purchased from OriGene Technologies, Inc. (Rockville, MD, USA). The other plasmids used in the present study have been described elsewhere [27] ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products