Nppc (NM_010933) Mouse Untagged Clone

SKU MC209051

Nppc (untagged) - Mouse natriuretic peptide type C (Nppc), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Nppc
• Synonyms: C; CNP; lb; lbab
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209051 representing NM_010933; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGCACCTCTCCCAGCTGATCGCCTGCGCCCTGCTGCTCGCGCTACTCTCGCTCCGGCCCTCTGAAGCCA; AGCCCGGGACACCACCGAAGGTCCCGAGAACCCCGCCAGGGGAGGAGCTGGCGGATTCCCAGGCAGCTGG; TGGCAATCAGAAAAAGGGTGACAAGACTCCAGGCAGCGGGGGAGCCAATCTCAAGGGAGACCGATCGCGA; CTGCTCCGGGACCTGCGTGTGGACACCAAGTCCCGGGCTGCTTGGGCCCGCCTTCTGCACGAGCACCCCA; ACGCGCGCAAATACAAAGGCGGCAACAAGAAGGGCTTGTCCAAAGGCTGCTTTGGCCTCAAGCTGGACCG; GATCGGCTCCATGAGCGGTCTGGGATGTTAG; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010933
• Insert Size: 381 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_010933.5, NP_035063.1
• RefSeq Size: 1042 bp
• RefSeq ORF: 381 bp
• Locus ID: 18159
• UniProt ID: Q61839
• Cytogenetics: 1 43.98 cM
• Summary: This gene encodes a member of the natriuretic peptide family. Natriuretic peptides are involved in the control of blood pressure, extracellular fluid volume and electrolyte homeostasis. The encoded protein also plays a role in sensory neuron bifurcation, and is a critical regulator of endochondral bone growth. The encoded protein is a ligand for the natriuretic peptide receptor B, and is synthesized as a preprohormone which is cleaved to produce a mature peptide. Mutations in this gene are associated with dwarfism resulting from impaired endochondral ossification. [provided by RefSeq, Apr 2011]