OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dnaja1 (NM_008298) Mouse Untagged Clone

Be the first to review this product
SKU
MC208719
Dnaja1 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA335012 Rabbit Polyclonal Anti-Dnaja1 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dnaja1 or NM_008298"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dnaja1
Synonyms Hsj; HSJ-2; Hsj2; Nedd; Nedd7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208719 representing NM_008298
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAAGAAACCACTTACTACGATGTTTTGGGGGTAAAACCCAATGCCACCCAGGAAGAATTGAAAA
AGGCATATAGAAAATTGGCCTTGAAGTACCACCCTGATAAGAATCCAAATGAAGGGGAAAAGTTTAAACA
GATTTCTCAAGCTTATGAAGTTCTTGCTGATTCCAAAAAAAGGGAACTATATGATAAAGGAGGGGAGCAG
GCGATTAAAGAGGGCGGAGCAGGTGGTGGTTTTGGCTCACCCATGGATATCTTTGATATGTTCTTTGGAG
GAGGAGGAAGAATGCAAAGAGAAAGGAGAGGTAAAAATGTTGTTCATCAGCTCTCAGTGACCTTAGAAGA
CTTATATAATGGTGCAACAAGAAAACTGGCTCTGCAAAAGAATGTGATTTGTGACAAATGTGAAGGCCGA
GGTGGTAAGAAAGGAGCAGTAGAGTGCTGTCCCAACTGCCGGGGGACAGGTATGCAGATAAGGATTCATC
AGATTGGACCAGGAATGGTTCAGCAAATTCAGTCAGTGTGCATGGAGTGCCAGGGTCATGGAGAACGCAT
CAGTCCAAAAGACAGATGTAAAAGCTGCAATGGAAGAAAAATAGTTCGAGAGAAGAAAATTTTAGAAGTT
CATATTGATAAAGGCATGAAAGATGGTCAGAAGATAACATTCCACGGTGAAGGAGACCAAGAACCAGGAC
TGGAGCCAGGAGATATTATCATTGTGTTAGATCAGAAGGACCATGCTGTTTTTACAAGGCGAGGAGAAGA
CCTTTTCATGTGTATGGACATACAGCTGGTTGAAGCATTGTGCGGCTTCCAAAAGCCAATATCTACTCTT
GACAACCGAACCATAGTCATCACCTCTCATCCAGGTCAGATTGTCAAGCATGGGGATATAAAATGTGTGC
TAAATGAAGGTATGCCAATATACCGTCGGCCATATGAAAAGGGACGTCTAATCATTGAGTTTAAGGTAAA
CTTTCCTGAAAATGGCTTTCTCTCTCCTGATAAACTCTCTTTGCTGGAAAAACTCCTTCCTGAAAGGAAG
GAAGTAGAAGAGACTGATGAAATGGATCAGGTAGAACTGGTGGACTTTGATCCAAATCAGGAAAGACGGC
GTCATTATAATGGAGAAGCGTATGAGGATGATGAACATCACCCCAGAGGTGGCGTTCAGTGTCAGACCTC
TTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_008298
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008298.6, NP_032324.1
RefSeq Size 3410 bp
RefSeq ORF 1194 bp
Locus ID 15502
UniProt ID P63037
Cytogenetics 4 A5
Summary The protein encoded by this gene is a member of the DnaJ family, whose members act as cochaperones of heat shock protein 70. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. Mice deficient for this gene display reduced levels of activation‐induced deaminase, an enzyme that deaminates deoxycytidine at the immunoglobulin genes during immune responses. In addition, mice lacking this gene exhibit severe defects in spermatogenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008298" in other vectors (4)
SKU Description Size Price
MG222273 Dnaja1 (tGFP-tagged) - Mouse DnaJ (Hsp40) homolog subfamily A member 1 (Dnaja1) transcript variant 2, (10ug) 10 ug
$657.00
MR222273 Dnaja1 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), transcript variant 2 10 ug
$289.00 $457.00
MR222273L3 Lenti ORF clone of Dnaja1 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), transcript variant 2 10 ug
$757.00
MR222273L4 Lenti ORF clone of Dnaja1 (mGFP-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), transcript variant 2 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products