Gnrh1 (NM_008145) Mouse Untagged Clone

SKU
MC208575
Gnrh1 (untagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1), (10ug)
  $240.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gnrh1
Synonyms Gnrh; Gnrh2; hpg; L; LH; LHRH; Lhrh1; Lnrh
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208575 representing NM_008145
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCTCAAACTGATGGCCGGCATTCTACTGCTGACTGTGTGTTTGGAAGGCTGCTCCAGCCAGCACT
GGTCCTATGGGTTGCGCCCTGGGGGAAAGAGAAACACTGAACACTTGGTTGAGTCTTTCCAAGAGATGGG
CAAGGAGGTGGATCAAATGGCAGAACCCCAGCACTTCGAATGTACTGTCCACTGGCCCCGTTCACCCCTC
AGGGATCTGCGAGGAGCTCTGGAAAGTCTGATTGAAGAGGAAGCCAGGCAGAAGAAGATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_008145
Insert Size 273 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008145.3, NP_032171.1
RefSeq Size 580 bp
RefSeq ORF 273 bp
Locus ID 14714
UniProt ID P13562
Cytogenetics 14 D1
Summary This gene encodes hypophysiotropic peptides belonging to the family of gonadotropin-releasing hormones that stimulate the release of gonadotropins and suppress secretion of prolactin from the pituitary gland. The encoded protein is proteolytically processed to generate two biologically active mature peptides. A deletional mutation encompassing the distal half of this gene in mice resulting in the loss of the encoded protein leads to hypogonadism and infertility. Alternative splicing results in multiple transcript variants. provided by RefSeq, Oct 2015
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008145" in other vectors (4)
SKU Description Size Price
MG226103 Gnrh1 (tGFP-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1), (10ug) 10 ug
$425.00
MR226103 Gnrh1 (Myc-DDK-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) 10 ug
$225.00
MR226103L3 Lenti ORF clone of Gnrh1 (Myc-DDK-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) 10 ug
$525.00
MR226103L4 Lenti ORF clone of Gnrh1 (mGFP-tagged) - Mouse gonadotropin releasing hormone 1 (Gnrh1) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products