Cd79a (NM_007655) Mouse Untagged Clone

SKU
MC208259
Cd79a (untagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd79a
Synonyms Ig-alpha; Iga; Igalpha; Ly-54; Ly54; mb-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_007655.3
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGGGGGTCTAGAAGCCCTCAGAGCCCTGCCTCTCCTCCTCTTCTTGTCATACGCCTGTTTGGGTC
CCGGATGCCAGGCCCTGCGGGTAGAAGGGGGTCCACCATCCCTGACGGTGAACTTGGGCGAGGAGGCCCG
CCTCACCTGTGAAAACAATGGCAGGAACCCTAATATCACATGGTGGTTCAGCCTTCAGTCTAACATCACA
TGGCCCCCAGTGCCACTGGGTCCTGGCCAGGGTACCACAGGCCAGCTGTTCTTCCCCGAAGTAAACAAGA
ACCACAGGGGCTTGTACTGGTGCCAAGTGATAGAAAACAACATATTAAAACGCTCCTGTGGTACTTACCT
CCGCGTGCGCAATCCAGTCCCTAGGCCCTTCCTGGACATGGGGGAAGGTACCAAGAACCGCATCATCACA
GCAGAAGGGATCATCTTGCTGTTCTGTGCAGTGGTGCCAGGGACGCTGCTGCTATTCAGGAAACGGTGGC
AAAATGAGAAGTTTGGGGTGGACATGCCAGATGACTATGAAGATGAAAATCTCTATGAGGGCCTGAACCT
TGATGACTGTTCTATGTATGAGGACATCTCCAGGGGACTCCAGGGCACCTACCAGGATGTGGGCAACCTC
CACATTGGAGATGCCCAGCTGGAAAAGCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_007655
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007655.3, NP_031681.2
RefSeq Size 1327 bp
RefSeq ORF 663 bp
Locus ID 12518
UniProt ID P11911
Cytogenetics 7 13.49 cM
Summary Required in cooperation with CD79B for initiation of the signal transduction cascade activated by binding of antigen to the B-cell antigen receptor complex (BCR) which leads to internalization of the complex, trafficking to late endosomes and antigen presentation. Also required for BCR surface expression and for efficient differentiation of pro- and pre-B-cells. Stimulates SYK autophosphorylation and activation. Binds to BLNK, bringing BLNK into proximity with SYK and allowing SYK to phosphorylate BLNK. Also interacts with and increases activity of some Src-family tyrosine kinases. Represses BCR signaling during development of immature B-cells.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007655" in other vectors (4)
SKU Description Size Price
MG222619 Cd79a (tGFP-tagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a), (10ug) 10 ug
$500.00
MR222619 Cd79a (Myc-DDK-tagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a) 10 ug
$289.00 $300.00
MR222619L3 Lenti ORF clone of Cd79a (Myc-DDK-tagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a) 10 ug
$600.00
MR222619L4 Lenti ORF clone of Cd79a (mGFP-tagged) - Mouse CD79A antigen (immunoglobulin-associated alpha) (Cd79a) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products