OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Bcl2 (NM_177410) Mouse Untagged Clone

Be the first to review this product
SKU
MC208179
Bcl2 (untagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Bcl2 or NM_177410"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Bcl2
Synonyms AW986256; Bcl-; Bcl-2; C430015F12Rik; D630044D05Rik; D830018M01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_177410.2
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCAAGCCGGGAGAACAGGGTATGATAACCGGGAGATCGTGATGAAGTACATACATTATAAGCTGT
CACAGAGGGGCTACGAGTGGGATGCTGGAGATGCGGACGCGGCGCCCCTGGGGGCTGCCCCCACCCCTGG
CATCTTCTCCTTCCAGCCTGAGAGCAACCCAATGCCCGCTGTGCACCGGGACATGGCTGCCAGGACGTCT
CCTCTCAGGCCCCTCGTTGCCACCGCTGGGCCTGCGCTCAGCCCTGTGCCACCTGTGGTCCATCTGACCC
TCCGCCGGGCTGGGGATGACTTCTCTCGTCGCTACCGTCGTGACTTCGCAGAGATGTCCAGTCAGCTGCA
CCTGACGCCCTTCACCGCGAGGGGACGCTTTGCCACGGTGGTGGAGGAACTCTTCAGGGATGGGGTGAAC
TGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACAGGGAGATGT
CACCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCATCTGCACACCTGGATCCA
GGATAACGGAGGCTGGGTAGGTGCATGTCTGGTTGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_177410
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_177410.2, NP_803129.2
RefSeq Size 2529 bp
RefSeq ORF 600 bp
Locus ID 12043
Cytogenetics 1 49.76 cM
Summary This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_177410" in other vectors (4)
SKU Description Size Price
MG226785 Bcl2 (tGFP-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2) transcript variant 2, (10ug) 10 ug
$650.00
MR226785 Bcl2 (Myc-DDK-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 10 ug
$450.00
MR226785L3 Lenti ORF clone of Bcl2 (Myc-DDK-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 10 ug
$750.00
MR226785L4 Lenti ORF clone of Bcl2 (mGFP-tagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 2 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products