OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Npm1 (NM_008722) Mouse Untagged Clone

Be the first to review this product
SKU
MC208035
Npm1 (untagged) - Mouse nucleophosmin 1 (Npm1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA362939 NPM1 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Npm1 or NM_008722"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Npm1
Synonyms B23; NO38; Npm
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208035 representing NM_008722
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGGCTGTGAACTAA
AGGCTGACAAAGACTATCACTTTAAAGTGGATAATGATGAAAATGAGCACCAGTTGTCATTAAGAACGGT
CAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGTAGAGGCAGAAGCAATGAACTATGAAGGCAGT
CCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAACCAACAGTTTCCCTAGGGGGCTTTGAAA
TTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAGGGCCTGTGCACATTAGTGGACAGCATCTAGT
AGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGAGGAGGACGTAAAACTCTTAGGCATGTCTGGA
AAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAGAAAAAAGTAAAACTTGATGAAGATGATGAGG
ACGATGATGAGGACGATGAGGATGATGAGGATGATGATGATGATGATTTTGATGAAGAGGAAACTGAAGA
AAAGGTCCCAGTGAAGAAATCTGTACGAGATACCCCAGCCAAAAATGCACAAAAATCAAACCAAAATGGA
AAAGACTTAAAACCATCAACACCGAGATCAAAGGGTCAAGAGTCCTTCAAAAAACAGGAAAAGACTCCTA
AAACACCAAAAGGACCTAGTTCTGTAGAAGACATTAAGGCAAAAATGCAAGCAAGTATAGAAAAAGGCGG
TTCTCTTCCCAAAGTGGAAGCCAAGTTCATTAATTATGTGAAGAATTGTTTCCGGATGACTGACCAGGAG
GCTATTCAAGATCTCTGGCAGTGGAGGAAATCTCTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_008722
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008722.3, NP_032748.1
RefSeq Size 1440 bp
RefSeq ORF 879 bp
Locus ID 18148
UniProt ID Q61937
Cytogenetics 11 A4
Summary Involved in diverse cellular processes such as ribosome biogenesis, centrosome duplication, protein chaperoning, histone assembly, cell proliferation, and regulation of tumor suppressors p53/TP53 and ARF. Binds ribosome presumably to drive ribosome nuclear export. Associated with nucleolar ribonucleoprotein structures and bind single-stranded nucleic acids. Acts as a chaperonin for the core histones H3, H2B and H4. Stimulates APEX1 endonuclease activity on apurinic/apyrimidinic (AP) double-stranded DNA but inhibits APEX1 endonuclease activity on AP single-stranded RNA. May exert a control of APEX1 endonuclease activity within nucleoli devoted to repair AP on rDNA and the removal of oxidized rRNA molecules. In concert with BRCA2, regulates centrosome duplication. Regulates centriole duplication: phosphorylation by PLK2 is able to trigger centriole replication. Negatively regulates the activation of EIF2AK2/PKR and suppresses apoptosis through inhibition of EIF2AK2/PKR autophosphorylation. Antagonizes the inhibitory effect of ATF5 on cell proliferation and relieves ATF5-induced G2/M blockade. In complex with MYC enhances the transcription of MYC target genes.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008722" in other vectors (3)
SKU Description Size Price
MR204001 Npm1 (Myc-DDK-tagged) - Mouse nucleophosmin 1 (Npm1) 10 ug
$289.00 $300.00
MR204001L3 Lenti ORF clone of Npm1 (Myc-DDK-tagged) - Mouse nucleophosmin 1 (Npm1) 10 ug
$600.00
MR204001L4 Lenti ORF clone of Npm1 (mGFP-tagged) - Mouse nucleophosmin 1 (Npm1) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products