OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Nkx6-1 (NM_144955) Mouse Untagged Clone

Be the first to review this product
SKU
MC208034
Nkx6 (untagged) - Mouse NK6 homeobox 1 (Nkx6-1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
  $503.00
5 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Nkx6-1 or NM_144955"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nkx6-1
Synonyms Nkx6.1; NKX6A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208034 representing NM_144955
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTAGCTGTGGGGGCGATGGAGGGCCCTCGGCAGAGCGCGTTCCTGCTCAGCAGCCCGCCCCTGGCCG
CCCTGCACAGTATGGCCGAGATGAAGACCCCGCTCTACCCCGCCGCTTATCCCCCGCTGCCCACCGGGCC
CCCCTCCTCCTCGTCCTCGTCCTCCTCGTCCTCGTCGCCCTCCCCACCTTTGGGCTCACATAACCCGGGC
GGCTTGAAGCCCCCGGCCGCGGGGGGCCTCTCGTCCCTGGGCAGTCCCCCGCAGCAGCTTTCGGCGGCCA
CCCCACACGGCATCAACGACATCCTGAGCCGGCCCTCTATGCCGGTGGCCTCGGGGGCCGCCCTGCCCTC
CGCCTCGCCCTCCGGGTCTTCCTCCTCCTCCTCCTCGTCCGCCTCCGCCACCTCGGCCTCTGCGGCGGCC
GCCGCCGCCGCTGCTGCTGCCGCCGCTGCCGCCTCGTCGCCCGCTGGGCTGCTGGCCGGCCTGCCCCGCT
TCAGCAGCCTGAGCCCTCCGCCACCGCCGCCCGGGCTCTACTTTAGCCCCAGCGCCGCGGCTGTGGCCGC
CGTGGGCCGGTACCCCAAGCCCCTGGCCGAGCTGCCCGGTCGGACGCCCATCTTCTGGCCCGGAGTGATG
CAGAGTCCGCCGTGGAGGGACGCGCGCCTTGCCTGTACCCCCCATCAAGGATCCATTTTGTTGGACAAAG
ATGGGAAGAGAAAACACACCAGACCCACGTTCTCTGGACAGCAAATCTTCGCCCTGGAGAAGACTTTCGA
ACAAACGAAGTACTTGGCAGGACCAGAGAGAGCACGCTTGGCCTATTCTCTGGGGATGACGGAGAGTCAG
GTCAAGGTCTGGTTCCAGAACCGCAGGACCAAGTGGAGAAAGAAGCACGCAGCCGAGATGGCCACGGCCA
AGAAGAAGCAGGACTCGGAGACCGAGAGGCTCAAGGGGACTTCGGAGAATGAGGAGGATGACGACGATTA
CAACAAACCTCTGGACCCGAACTCTGACGACGAGAAAATCACTCAGCTGCTGAAAAAGCACAAATCGAGC
GGTGGCAGCCTCCTGCTGCACGCGTCGGAGGCCGAGGGCTCGTCCTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII |
ACCN NM_144955
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_144955.2, NP_659204.1
RefSeq Size 1808 bp
RefSeq ORF 1098 bp
Locus ID 18096
UniProt ID Q99MA9
Cytogenetics 5 E4- E5
Summary Transcription factor which binds to specific A/T-rich DNA sequences in the promoter regions of a number of genes. Required for the development of insulin-producing beta cells in the islets of Langerhans at the secondary transition (PubMed:11076772). Involved in transcriptional regulation of the insulin gene. Together with NKX2-2 and IRX3, restricts the generation of motor neurons to the appropriate region of the neural tube. Belongs to the class II proteins of neuronal progenitor factors, which are induced by SHH signals.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_144955" in other vectors (3)
SKU Description Size Price
MR212146 Nkx6 (Myc-DDK-tagged) - Mouse NK6 homeobox 1 (Nkx6-1) 10 ug
$686.00
MR212146L3 Lenti ORF clone of Nkx6 (Myc-DDK-tagged) - Mouse NK6 homeobox 1 (Nkx6-1) 10 ug
$986.00
MR212146L4 Lenti ORF clone of Nkx6 (mGFP-tagged) - Mouse NK6 homeobox 1 (Nkx6-1) 10 ug
$986.00

file-alt Citations

Novel Innate Immune Genes Regulating the Macrophage Response to Gram Positive Bacteria
Alper, Warg, De Arras et al
Genetics (2016)
Cited by 8
AI Summary: OriGene products contributed to this study by providing plasmids containing full-length cDNAs for Nkx6.1, Bdkrb1 (Clone ID: 4753410), and Blnk (Clone ID: 5213221), which were used for gene overexpression experiments in RAW264.7 macrophages to assess their roles in regulating the innate immune response to Gram positive bacteria.
Snippet: Gene overexpression in RAW264.7 cells Plasmids containing full-length cDNAs with stop codon cloned downstream of the CMV promoter were obtained for Nkx6.1 (Origene);Bdkrb1 (Clone ID: 4753410), Blnk (Clone ID: 5213221), ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products