OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tnfsf15 (NM_177371) Mouse Untagged Clone

Be the first to review this product
SKU
MC207960
Tnfsf15 (untagged) - Mouse tumor necrosis factor (ligand) superfamily, member 15 (Tnfsf15), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA386220 Recombinant Anti-TL1A (Clone TAN2-2)
200 ug
$770.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tnfsf15 or NM_177371"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tnfsf15
Synonyms Tl1; Tl1a; Tnlg1b; Vegi
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207960 representing NM_177371
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAGGAGCTGGGGTTGGGCTTCGGAGAAGGAGTCCCAGTGGAAGTGCTGCCGGAAGGCTGTAGAC
ACAGGCCAGAGGCCAGGGCCGGGCTAGCTGCCAGGAGCAAAGCCTGCCTGGCTCTCACCTGCTGCCTGTT
GTCATTTCCCATCCTCGCAGGACTTAGCACCCTCCTAATGGCTGGCCAGCTCCGGGTCCCCGGAAAAGAC
TGTATGCTTCGGGCCATAACAGAAGAGAGATCTGAGCCTTCACCACAGCAAGTTTACTCACCTCCCAGAG
GCAAGCCGAGAGCACACCTGACAATTAAGAAACAAACCCCAGCACCACATCTGAAAAATCAGCTCTCTGC
TCTACACTGGGAACATGACCTAGGGATGGCCTTCACCAAGAACGGGATGAAGTACATCAACAAATCCCTG
GTGATCCCAGAGTCAGGAGACTATTTCATCTACTCCCAGATCACATTCCGAGGGACCACATCTGTGTGTG
GTGACATCAGTCGGGGGAGACGACCAAACAAGCCAGACTCCATCACCATGGTTATCACCAAGGTAGCAGA
CAGCTACCCTGAGCCTGCCCGCCTACTAACAGGGTCCAAGTCTGTGTGTGAAATAAGCAACAACTGGTTC
CAGTCCCTCTACCTTGGGGCCACGTTCTCCTTGGAAGAAGGAGACAGACTAATGGTAAACGTCAGTGACA
TCTCCTTGGTGGATTACACAAAAGAAGATAAAACTTTCTTTGGAGCTTTCTTGCTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_177371
Insert Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC096494, AAH96494
RefSeq Size 3331 bp
RefSeq ORF 813 bp
Locus ID 326623
UniProt ID Q5UBV8
Cytogenetics 4 C1
Summary Receptor for TNFRSF25 and TNFRSF6B. Mediates activation of NF-kappa-B. Inhibits vascular endothelial growth and angiogenesis (in vitro). Promotes activation of caspases and apoptosis (By similarity). Promotes splenocyte alloactivation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_177371" in other vectors (4)
SKU Description Size Price
MG203224 Tnfsf15 (tGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 15 (Tnfsf15) 10 ug
$489.00 $500.00
MR203224 Tnfsf15 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 15 (Tnfsf15) 10 ug
$289.00 $300.00
MR203224L3 Lenti ORF clone of Tnfsf15 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 15 (Tnfsf15) 10 ug
$600.00
MR203224L4 Lenti ORF clone of Tnfsf15 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 15 (Tnfsf15) 10 ug
$600.00

file-alt Citations

Cloning, expression, and functional characterization of TL1A-Ig
Khan, Tsai, Schreiber et al
J. Immunol. (2013) 190 (4), 1540-50 DOI: 10.4049/jimmunol.1201908
Cited by 48
AI Summary: OriGene contributed to this study by providing the mGS cDNA, which was used for cloning and expression experiments to characterize the TL1A-Ig fusion protein.
Snippet: The mGS cDNA was purchased from OriGene, and the open reading frame was PCR amplified with primers containing the MLU1/SAL1 restriction sites. Cells and culture conditions. ... Reducing conditions resulted in an apparent molecular mass band of ∼50 kDa (Fig. 2A).
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products