OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Egln1 (NM_053207) Mouse Untagged Clone

Be the first to review this product
SKU
MC207840
Egln1 (untagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $225.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Egln1 or NM_053207"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Egln1
Synonyms AI503754; C1orf12; Hif-p4h-2; HIF-PH2; HPH-2; ORF13; Phd2; SM-20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207840 representing NM_053207
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTGCTTGTTACCCAGGCAACGGAACAGGCTATGTCCGTCACGTTGATAACCCAAATGGAGATGGAA
GATGCGTGACATGTATATATTATCTAAATAAAGACTGGGACGCCAAGGTAAGTGGAGGTATTCTTCGAAT
TTTTCCAGAAGGCAAAGCCCAGTTTGCTGACATTGAACCCAAATTTGATAGACTGCTGTTTTTCTGGTCT
GACCGGCGTAACCCTCATGAAGTACAGCCAGCATACGCCACAAGGTACGCAATAACTGTTTGGTATTTTG
ATGCAGATGAGCGAGCGAGAGCTAAAGTAAAATATCTAACAGGTGAGAAAGGTGTGAGGGTTGAACTCAA
GCCCAATTCAGTCAGCAAAGACGTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_053207
Insert Size 378 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_053207.2, NP_444437.2
RefSeq Size 3524 bp
RefSeq ORF 1203 bp
Locus ID 112405
UniProt ID Q91YE3
Cytogenetics 8 E2
Summary Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_053207" in other vectors (4)
SKU Description Size Price
MG200656 Egln1 (tGFP-tagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1) 10 ug
$425.00
MR200656 Egln1 (Myc-DDK-tagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1) 10 ug
$225.00
MR200656L3 Lenti ORF clone of Egln1 (Myc-DDK-tagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1) 10 ug
$525.00
MR200656L4 Lenti ORF clone of Egln1 (mGFP-tagged) - Mouse EGL nine homolog 1 (C. elegans) (Egln1) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products