Naa50 (NM_028108) Mouse Untagged Clone

SKU
MC207717
Naa50 (untagged) - Mouse N(alpha)-acetyltransferase 50, NatE catalytic subunit (Naa50), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Naa50
Synonyms 2600005K24Rik; 2810441M03Rik; AW112078; Mak3; Mak3p; Nat5; Nat13; San
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207717 representing NM_028108
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGGCCGGATCGAGCTGGGAGATGTGACGCCACACAATATTAAACAGTTGAAGAGACTGAACCAGG
TCATCTTTCCAGTCAGCTATAATGATAAATTCTACAAGGATGTGCTAGAGGTTGGCGAGCTAGCAAAACT
TGCATATTTCAATGATATAGCTGTAGGTGCAGTGTGCTGCAGGGTGGATCATTCACAGAATCAAAAGAGA
CTTTACATCATGACACTAGGATGCCTTGCACCTTACCGAAGACTAGGAATAGGAACTAAAATGTTAAATC
ATGTCCTAAACATCTGTGAGAAGGATGGCACTTTTGACAATATCTATCTGCATGTCCAGATCAGCAATGA
GTCAGCGATTGACTTTTACCGGAAGTTTGGCTTTGAGATTATCGAGACAAAGAAGAACTACTATAAGAGG
ATAGAGCCTGCAGACGCGCATGTGCTTCAGAAAAACCTCAAAGTCCCATCTGGTCAGAATGCAGAGACAC
AGAAGACAGACAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_028108
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_028108.3, NP_082384.1
RefSeq Size 4526 bp
RefSeq ORF 507 bp
Locus ID 72117
UniProt ID Q6PGB6
Cytogenetics 16 B4
Summary N-alpha-acetyltransferase that acetylates the N-terminus of proteins that retain their initiating methionine. Has a broad substrate specificity: able to acetylate the initiator methionine of most peptides, except for those with a proline in second position. Also displays N-epsilon-acetyltransferase activity by mediating acetylation of the side chain of specific lysines on proteins. Autoacetylates in vivo. The relevance of N-epsilon-acetyltransferase activity is however unclear: able to acetylate H4 in vitro, but this result has not been confirmed in vivo. Component of a N-alpha-acetyltransferase complex containing NAA10 and NAA15, but NAA50 does not influence the acetyltransferase activity of NAA10: this multiprotein complex probably constitutes the major contributor for N-terminal acetylation at the ribosome exit tunnel, with NAA10 acetylating all amino termini that are devoid of methionine and NAA50 acetylating other peptides. Required for sister chromatid cohesion during mitosis by promoting binding of CDCA5/sororin to cohesin: may act by counteracting the function of NAA10.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_028108" in other vectors (4)
SKU Description Size Price
MG201391 Naa50 (tGFP-tagged) - Mouse N-acetyltransferase 13 (Nat13) 10 ug
$500.00
MR201391 Naa50 (Myc-DDK-tagged) - Mouse N(alpha)-acetyltransferase 50, NatE catalytic subunit (Naa50) 10 ug
$289.00 $300.00
MR201391L3 Lenti ORF clone of Naa50 (Myc-DDK-tagged) - Mouse N(alpha)-acetyltransferase 50, NatE catalytic subunit (Naa50) 10 ug
$600.00
MR201391L4 Lenti ORF clone of Naa50 (mGFP-tagged) - Mouse N(alpha)-acetyltransferase 50, NatE catalytic subunit (Naa50) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products