Litaf (NM_019980) Mouse Untagged Clone

SKU
MC207534
Litaf (untagged) - Mouse LPS-induced TN factor (Litaf), (10ug)
  $165.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Litaf
Synonyms 3222402J11Rik; C85531; N4WBP3; TBX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207534 representing NM_019980
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGCTCCAGGACCTTACCAAGCAGCTGCAGGCCCTTCAGTAGTGCCCACCGCACCCCCAACCTATG
AAGAAACAGTGGGTGTCAACAGTTACTACCCAACGCCCCCAGCACCTATGCCGGGACCAGCCACAGGGCT
CATTACAGGCCCAGATGGGAAGGGAATGAATCCACCTTCGTACTACACCCAGCCTGTGCCTGTCCCCAAC
GCCAACGCAATTGCCGTGCAGACCGTTTATGTGCAGCAGCCTGTCTCCTTCTATGACCGCCCCGTCCAGA
TGTGCTGTCCTTCCTGCAGCAAGATGATCGTGACCCAGCTGTCCTACAATGCGGGAGCCCTCACCTGGCT
CTCCTGTGGCAGTCTGTGTCTGCTGGGATGCGTTGCTGGCTGCTGCTTCATCCCGTTCTGCGTAGACGCC
CTACAGGATGTGGACCACTACTGCCCCAACTGCAAAGCGCTCCTGGGCACCTACAAGCGCTTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_019980
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019980.2, NP_064364.1
RefSeq Size 2240 bp
RefSeq ORF 486 bp
Locus ID 56722
UniProt ID Q9JLJ0
Cytogenetics 16 A1
Summary Plays a role in endosomal protein trafficking and in targeting proteins for lysosomal degradation. Plays a role in targeting endocytosed EGFR and ERGG3 for lysosomal degradation, and thereby helps downregulate downstream signaling cascades (PubMed:23166352). Helps recruit the ESCRT complex components TSG101, HGS and STAM to cytoplasmic membranes. Probably plays a role in regulating protein degradation via its interaction with NEDD4 (By similarity). May also contribute to the regulation of gene expression in the nucleus. Binds DNA (in vitro) and may play a synergistic role with STAT6 in the nucleus in regulating the expression of various cytokines (PubMed:15793005, PubMed:21980379). May regulate the expression of numerous cytokines, such as TNF, CCL2, CCL5, CXCL1, IL1A and IL10 (PubMed:12355436, PubMed:15025820, PubMed:16954198, PubMed:21980379, PubMed:22160695).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019980" in other vectors (4)
SKU Description Size Price
MG201259 Litaf (tGFP-tagged) - Mouse LPS-induced TN factor (Litaf) 10 ug
$350.00
MR201259 Litaf (Myc-DDK-tagged) - Mouse LPS-induced TN factor (Litaf) 10 ug
$289.00
MR201259L3 Lenti ORF clone of Litaf (Myc-DDK-tagged) - Mouse LPS-induced TN factor (Litaf) 10 ug
$450.00
MR201259L4 Lenti ORF clone of Litaf (mGFP-tagged) - Mouse LPS-induced TN factor (Litaf) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products