OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mog (NM_010814) Mouse Untagged Clone

Be the first to review this product
SKU
MC207329
Mog (untagged) - Mouse myelin oligodendrocyte glycoprotein (Mog), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mog or NM_010814"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mog
Synonyms B230317G11Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207329 representing NM_010814
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTGTTTGTGGAGCTTCTCTTTGCCCAGCTGCTTCCTCTCCCTTCTCCTCCTCCTTCTCCTCCAGT
TGTCATGCAGCTATGCAGGACAATTCAGAGTGATAGGACCAGGGTATCCCATCCGGGCTTTAGTTGGGGA
TGAAGCAGAGCTGCCGTGCCGCATCTCTCCTGGGAAAAATGCCACGGGCATGGAGGTGGGTTGGTACCGT
TCTCCCTTCTCAAGAGTGGTTCACCTCTACCGAAATGGCAAGGACCAAGATGCAGAGCAAGCACCTGAAT
ACCGGGGACGCACAGAGCTTCTGAAAGAGACTATCAGTGAGGGAAAGGTTACCCTTAGGATTCAGAACGT
GAGATTCTCAGATGAAGGAGGCTACACCTGCTTCTTCAGAGACCACTCTTACCAAGAAGAGGCAGCAATG
GAGTTGAAAGTGGAAGATCCCTTCTATTGGGTCAACCCCGGTGTGCTGACTCTCATCGCACTTGTGCCTA
CGATCCTCCTGCAGGTCTCTGTAGGCCTTGTATTCCTCTTCCTGCAGCACAGACTGAGAGGAAAACTTCG
TGCAGAAGTAGAGAATCTCCATCGGACTTTTGATCCTCACTTCCTGAGGGTGCCCTGCTGGAAGATAACA
CTGTTTGTTATTGTGCCTGTTCTTGGACCCCTGGTTGCCTTGATCATCTGCTACAACTGGCTGCACCGAA
GACTGGCAGGACAGTTTCTTGAAGAGCTAAGAAACCCCCTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_010814
Insert Size 744 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC080860, AAH80860
RefSeq Size 1725 bp
RefSeq ORF 744 bp
Locus ID 17441
UniProt ID Q61885
Cytogenetics 17 19.16 cM
Summary Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010814" in other vectors (4)
SKU Description Size Price
MG203093 Mog (tGFP-tagged) - Mouse myelin oligodendrocyte glycoprotein (Mog) 10 ug
$650.00
MR203093 Mog (Myc-DDK-tagged) - Mouse myelin oligodendrocyte glycoprotein (Mog) 10 ug
$450.00
MR203093L3 Lenti ORF clone of Mog (Myc-DDK-tagged) - Mouse myelin oligodendrocyte glycoprotein (Mog) 10 ug
$750.00
MR203093L4 Lenti ORF clone of Mog (mGFP-tagged) - Mouse myelin oligodendrocyte glycoprotein (Mog) 10 ug
$750.00

file-alt Citations

Citrullinated Vimentin Presented on MHC-II in Tumor Cells Is a Target for CD4+ T-Cell-Mediated Antitumor Immunity
Brentville, Metheringham, Gunn et al
Cancer Res. (2016) 76 (3), 548-60 DOI: 10.1158/0008-5472.CAN-15-1085
AI Summary: OriGene’s plasmid MC207329, encoding full-length murine Myelin Oligodendrocyte Glycoprotein cDNA, was used in this study for cloning and expression experiments related to antigen presentation and immune response analyses.
Snippet: The plasmid MC207329 (Origene) encoding untagged full- length murine Myelin Oligodendrocyte Glycoprotein cDNA (NM_010814) was cloned into the SgfI/MluI mcs of the mam- malian expression vector pCMV 6. After sequence confirmation endotoxin-free plasmid ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products