Cd247 (NM_001113391) Mouse Untagged Clone

SKU
MC207245
Cd247 (untagged) - Mouse CD247 antigen (Cd247), transcript variant zeta, (10ug)
  $165.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd247
Synonyms 4930549J05Rik; A430104F18Rik; AW552088; Cd3; Cd3-eta; Cd3-zeta; Cd3h; Cd3z; Cd3zeta; T3z; Tcrk
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207245 representing NM_001113391
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTGGAAAGTGTCTGTTCTCGCCTGCATCCTCCACGTGCGGTTCCCAGGAGCAGAGGCACAGAGCT
TTGGTCTGCTGGATCCCAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGGAGTCATCATCAC
AGCCCTGTACCTGAGAGCAAAATTCAGCAGGAGTGCAGAGACTGCTGCCAACCTGCAGGACCCCAACCAG
CTCTACAATGAGCTCAATCTAGGGCGAAGAGAGGAATATGACGTCTTGGAGAAGAAGCGGGCTCGGGATC
CAGAGATGGGAGGCAAACAGCAGAGGAGGAGGAACCCCCAGGAAGGCGTATACAATGCACTGCAGAAAGA
CAAGATGGCAGAAGCCTACAGTGAGATCGGCACAAAAGGCGAGAGGCGGAGAGGCAAGGGGCACGATGGC
CTTTACCAGGGTCTCAGCACTGCCACCAAGGACACCTATGATGCCCTGCATATGCAGACCCTGGCCCCTC
GCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001113391
Insert Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001113391.2, NP_001106862.1
RefSeq Size 1686 bp
RefSeq ORF 495 bp
Locus ID 12503
UniProt ID P24161
Cytogenetics 1 73.14 cM
Summary Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. CD3Z ITAMs phosphorylation creates multiple docking sites for the protein kinase ZAP70 leading to ZAP70 phosphorylation and its conversion into a catalytically active enzyme. Plays an important role in intrathymic T-cell differentiation. Additionally, participates in the activity-dependent synapse formation of retinal ganglion cells (RGCs) in both the retina and dorsal lateral geniculate nucleus (dLGN).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (zeta) encodes the shortest isoform (zeta).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001113391" in other vectors (3)
SKU Description Size Price
MR201306 Cd247 (Myc-DDK-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta 10 ug
$289.00
MR201306L3 Lenti ORF clone of Cd247 (Myc-DDK-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta 10 ug
$450.00
MR201306L4 Lenti ORF clone of Cd247 (mGFP-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products