Ap3s2 (NM_009682) Mouse Untagged Clone

SKU
MC207227
Ap3s2 (untagged) - Mouse adaptor-related protein complex 3, sigma 2 subunit (Ap3s2), (10ug)
  $330.00
4 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ap3s2
Synonyms s3B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207227 representing NM_009682
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTCAGGCGATTCTGGTTTTCAACAACCATGGAAAACCGCGGCTGGTCCGCTTCTACCAGCGTTTTC
CAGAAGAAATTCAACAGCAGATTGTTCGAGAGACTTTCCATCTGGTCCTCAAGCGAGATGACAACATCTG
TAACTTCTTAGAAGGTGGAAGTTTGATTGGTGGCTCTGACTACAAACTGATTTACCGGCACTATGCCACC
CTCTACTTTGTGTTTTGTGTGGATTCATCAGAGAGTGAACTTGGGATCTTGGACCTCATCCAGGTTTTTG
TGGAGACACTGGATAAGTGTTTTGAGAATGTATGTGAGTTGGACTTGATCTTCCATATGGATAAGGTGCA
CTACATCCTGCAGGAGGTGGTGATGGGTGGAATGGTGTTGGAGACAAACATGAATGAAATTGTGGCTCAA
ATCGAAGCTCAAAACCGACTGGAGAAGTCGGAGGGCGGCCTCTCTGCAGCTCCAGCAAGGGCCGTGTCCG
CTGTGAAGAACATCAACCTCCCTGAGATCCCCAGGAACATCAACATCGGTGACCTCAACATCAAAGTCCC
CAACCTGTCCCAGTTTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_009682
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009682.3, NP_033812.3
RefSeq Size 5823 bp
RefSeq ORF 582 bp
Locus ID 11778
UniProt ID Q8BSZ2
Cytogenetics 7 D2
Summary Part of the AP-3 complex, an adaptor-related complex which is not clathrin-associated. The complex is associated with the Golgi region as well as more peripheral structures. It facilitates the budding of vesicles from the Golgi membrane and may be directly involved in trafficking to lysosomes. In concert with the BLOC-1 complex, AP-3 is required to target cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009682" in other vectors (4)
SKU Description Size Price
MG201869 Ap3s2 (tGFP-tagged) - Mouse adaptor-related protein complex 3, sigma 2 subunit (Ap3s2) 10 ug
$500.00
MR201869 Ap3s2 (Myc-DDK-tagged) - Mouse adaptor-related protein complex 3, sigma 2 subunit (Ap3s2) 10 ug
$289.00 $300.00
MR201869L3 Lenti ORF clone of Ap3s2 (Myc-DDK-tagged) - Mouse adaptor-related protein complex 3, sigma 2 subunit (Ap3s2) 10 ug
$600.00
MR201869L4 Lenti ORF clone of Ap3s2 (mGFP-tagged) - Mouse adaptor-related protein complex 3, sigma 2 subunit (Ap3s2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products