Scn2b (BC092225) Mouse Untagged Clone

SKU
MC206948
Scn2b (untagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081), (10ug)
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Scn2b
Synonyms 2810451E09Rik; AI840361; Gm183
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206948 representing BC092225.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGTCTCACGGGGCTCAGTCTGTTTTTCTCTTTG
GTGCCCCCGGGGCGGAGCATGGAAGTCACAGCGCCCACCACTCTTAGTGTCCTCAATGGGTCCGATACC
CGCCTGCCCTGTACCTTCAACTCCTGCTACACCGTGAACCACAAGCAGTTCTCTCTTAACTGGACTTAC
CAGGAGTGTAACAATTGCACAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATTAACCTGAAGCTG
GAGCGGTTTGGAGACCGCGTGGAGTTCTCAGGGAACCCCAGTAAGTACGACGTGTCAGTGACTCTAAAG
AACGTGCAGCTAGAAGACGAAGGCATTTACAACTGCTACATTACCAACCCTCCAGACCGCCACCGCGGC
CACGGCAAGATTTACCTGCAGGTCCTTCTAGAAGTACCCCCAGAGCGGGACTCCACGGTGGCGGTCATC
GTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGG
AGGAAAAAAGAGCAGAAGCTGAGCACGGATGACCTGAAGACTGAAGAGGAAGGCAAGATGGATGGTGAG
GGCAACGCGGAAGATGGCACCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN BC092225
Insert Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC092225
RefSeq Size 3980 bp
RefSeq ORF 647 bp
Locus ID 72821
Cytogenetics 9 24.84 cM
MW 24.2 kDa
Summary Crucial in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. The subunit beta-2 causes an increase in the plasma membrane surface area and in its folding into microvilli. Interacts with TNR may play a crucial role in clustering and regulation of activity of sodium channels at nodes of Ranvier (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC092225" in other vectors (4)
SKU Description Size Price
MG202361 Scn2b (tGFP-tagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081) 10 ug
$489.00 $500.00
MR202361 Scn2b (Myc-DDK-tagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081) 10 ug
$289.00 $300.00
MR202361L3 Lenti ORF clone of Scn2b (Myc-DDK-tagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081) 10 ug
$600.00
MR202361L4 Lenti ORF clone of Scn2b (mGFP-tagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products