OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ptgds (BC038083) Mouse Untagged Clone

Be the first to review this product
SKU
MC206847
Ptgds (untagged) - Mouse prostaglandin D2 synthase (brain) (cDNA clone MGC:47365 IMAGE:4481308), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA311391 Goat Anti-Ptgds Antibody
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ptgds or BC038083"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ptgds
Synonyms PGD2, L-PGDS, 21kDa
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206847 representing BC038083
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCAAGACAGTGGTAGCCCCCTCCACAGAAGGCGGCCTCAATCTCACCTCTACCTTCCTCAGGAAAA
ACCAGTGTGAGACCAAGATCATGGTACTGCAGCCTGCGGGGGCTCCTGGACACTACACCTACAGCAGCCC
CCACTCGGGCAGCATCCACTCCGTGTCAGTGGTGGAGGCCAACTATGACGAGTACGCTCTGCTATTCAGC
AGAGGCACCAAGGGCCCAGGCCAGGACTTCCGCATGGCCACCCTCTACAGCAGAACCCAGACTCTGAAGG
ACGAGCTGAAGGAGAAATTCACCACCTTTAGCAAGGCCCAGGGCCTCACAGAGGAGGACATTGTTTTCCT
GCCCCAACCGGATAAGTGCATTCAAGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN BC038083
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC038083, AAH38083
RefSeq Size 1354 bp
RefSeq ORF 381 bp
Locus ID 19215
Cytogenetics 2 17.28 cM
Summary Catalyzes the conversion of PGH2 to PGD2, a prostaglandin involved in smooth muscle contraction/relaxation and a potent inhibitor of platelet aggregation. Involved in a variety of CNS functions, such as sedation, NREM sleep and PGE2-induced allodynia, and may have an anti-apoptotic role in oligodendrocytes. Binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophobic molecules and as a secretory retinoid and thyroid hormone transporter. Possibly involved in development and maintenance of the blood-brain, blood-retina, blood-aqueous humor and blood-testis barrier. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC038083" in other vectors (4)
SKU Description Size Price
MG200672 Ptgds (tGFP-tagged) - Mouse prostaglandin D2 synthase (brain) (cDNA clone MGC:47365 IMAGE:4481308) 10 ug
$489.00
MR200672 Ptgds (Myc-DDK-tagged) - Mouse prostaglandin D2 synthase (brain) (cDNA clone MGC:47365 IMAGE:4481308) 10 ug
$289.00
MR200672L3 Lenti ORF clone of Ptgds (Myc-DDK-tagged) - Mouse prostaglandin D2 synthase (brain) (cDNA clone MGC:47365 IMAGE:4481308) 10 ug
$450.00
MR200672L4 Lenti ORF clone of Ptgds (mGFP-tagged) - Mouse prostaglandin D2 synthase (brain) (cDNA clone MGC:47365 IMAGE:4481308) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products