OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Snw1 (BC049245) Mouse Untagged Clone

Be the first to review this product
SKU
MC206818
(untagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $165.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Snw1 or BC049245"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Snw1
Synonyms 2310008B08Rik; AW048543; NCoA-62; Skiip; SKIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206818 representing BC049245.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGAGCCAAGTGCTAATATGCCTTGGTTCAAGGGATGGAAAGTCACCTGCAAAGATGGCAGTGCC
AGTGGCACCACTCTGCTGGAAGCCAGGATAAAGACCAACAGATTTGTTCCTGATAAGGAGTTTTCTGGA
TCAGACCGCAAACAGAGAGGCCGAGAAGGACCAGTGCAGTTTGAGGAGGATCCTTTTGGTTTGGACAAG
TTTTTGGAAGAAGCCAAACAGCACGGTGGTTCTAAAAGACCCTCTGATAGCAGTCGCCCCAAGGAACAT
GAGCATGAAGGCAAGAAGCGGAGGAAAGAGTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN BC049245
Insert Size 309 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC049245
RefSeq Size 935 bp
RefSeq ORF 308 bp
Locus ID 66354
Cytogenetics 12 D2
MW 11.7 kDa
Summary Involved in pre-mRNA splicing as component of the spliceosome. Is required in the specific splicing of CDKN1A pre-mRNA; the function probably involves the recruitment of U2AF2 to the mRNA. Is proposed to recruit PPIL1 to the spliceosome. May be involved in cyclin-D1/CCND1 mRNA stability through the SNARP complex which associates with both the 3'end of the CCND1 gene and its mRNA. Involved in transcriptional regulation. Modulates TGF-beta-mediated transcription via association with SMAD proteins, MYOD1-mediated transcription via association with PABPN1, RB1-mediated transcriptional repression, and retinoid-X receptor (RXR)- and vitamin D receptor (VDR)-dependent gene transcription in a cell line-specific manner probably involving coactivators NCOA1 and GRIP1. Is involved in NOTCH1-mediated transcriptional activation. Binds to multimerized forms of Notch intracellular domain (NICD) and is proposed to recruit transcriptional coactivators such as MAML1 to form an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ to form a transcriptional activation complex by releasing SNW1 and redundant NOTCH1 NICD.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC049245" in other vectors (4)
SKU Description Size Price
MG200327 (tGFP-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 10 ug
$350.00
MR200327 (Myc-DDK-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 10 ug
$289.00
MR200327L3 Lenti ORF clone of MGC:55033 (Myc-DDK-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 10 ug
$450.00
MR200327L4 Lenti ORF clone of MGC:55033 (mGFP-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products