OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Stn1 (NM_175360) Mouse Untagged Clone

Be the first to review this product
SKU
MC205841
Obfc1 (untagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Stn1 or NM_175360"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Stn1
Synonyms 0610009H20Rik; 2310057J23Rik; AAF-44; AAF44; AI413458; Obfc1; RPA-32
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC029548
TACGCCGGCGGGAGTGTGCTCGCTTCCTTCTCGCAACCGGAACTGGTTCGGCAATCTTGGCTGGCTGCTC CTGCTTCGGGAGAAGTTGTAAACTGCTCTGATTTCTGCCTCTTTTTCCTTTCCTCCGCTCTTCCCAGAAG GTGAAAGGTCGAAGCGTGGATATACACACCTCCAGGGCCCCTAAAGTCCACGGCCACAGGGACTCTTCAT TACTCTCCGGATTCACTCGTTAAAACTCCTTTTTGGGAGTCTTGGCTCTGGGTTAGCAGATGCCACAGCC CTGCCTCTTGATGGAGTGTGAATCCAGTCCAAGGGAAGAGGAGATCCCGCCCCTCTTTTGGGGTCTGGAT CCTGTGTTTCTAGCCTTTGCAAAACTCTACATCAAGGATATCCTGGAGATGAAGGAGTCCCAACAAGTGC CAGGTACATATTTTTACAACGGGCATCCAATAAGGCGGGTAGATATCATGGGAGCTGTCATCAGCGTGAA AGAAAGAGAGACTTTCTACAGCTACGGAGTGGACGATGCCACTGGGGTTATAAACTGCGTCTGCTGGAAG AAGCTGAGCAATGCTGAGTCTTCCTCAGACCCAGCTATTCTGAGCACTGCGAGAGAGCTTAGCATGACAT CACAGCTTAAGAAGCTGCAGGAGACCATCGAGCAGAAAACCAGGATAGGGATTGGAGATATCATCCGAGT CCGAGGCTCTGTGCGCATGTTCCGAGAAGAGCGAGAGATCTGTGCCAACATTTATTATAAGGTGGACGAT CCAGTGTGGAACATGCAAATCGCAAGGATGCTTGAGCTGCCCAAGCTCTACCAGAAGGTGTACGACCAGC CCTTCCGTAACCCAGCCCTACAGGAGGAGGAAGCACTAAACAATAAAGACAATTTGGATCTCGCTGGCCT CACATCTTTGCTGAGTGAGAAAATTAAAGAATTCCTCCAGGAGAAGAAAATGCAAAGCTTCTACCAGCAG GAGTTAGAGACAGTGGAGTCTTTGCAGTCTCTGGCCAGTCGGCCTGTGACCCACAGCACGGGCTCGGACC AAGTGGAGTTAAAGGACAGTGGCACTTCTGGCGTAGCGCAGAGAGTGTTTAAGAATGCTCTCCAGCTGCT TCAGGAAAAAGGACTCGTGTTCCAGAGAGACAGTGGCTCTGATAAGCTGTACTACGTAACCACCAAAGAC AAAGACCTGCAGCAGAAGATCTACCACATCATTAAGGAAGACTGTCAGAAACCAAACCATATGGAGAAGG GCTGCCACCTGCTACACATCCTGAAGTGCGTGCACCTCAACCTCCGCTGGGACCTGAGCAAGGCTGTGCT GCAGCGGGTGCTGGAGCTCCTGGAGGACCAGAGTGACATCGTCAGCACCGCGGACCACTACTACGCGGCC TTCTGAGCAGAGCCGCGGAGCAAAGCCGGAGGCTCTACCCTAGGTTCTGCTCACAGGCCCAGTACAGACT TACACATGTATAATCCCATAGTAAGCTCTGATAAGTCACAGGAAAATAGGACTGAGACAGACGGCTCTGA TGTCAGCCATGACATACACAAGCCCTCCTTGTCAGCTCCCTGGCTGGACTTCCCATCACTCAGAACAGAA TGGGAGAAAAACGGTGTTGCTGGTTTAATCCCTGTGTCTGAATTCAGGGGCCCCGTCTCGATAGAGGGGC ATCCCAGGGCGAAGGCTCCTCCACATCTGAACTGGAGCAGAAATAGCAGACTACACCGTCTGAAAACGTC ACACTCCAAGCTACCACATACATCCCCACCAGGCTCCCCTGATGTGTCAAGAGCTCGTATAGGCGCATCG TCTCCTACAGTAATTGACGTTTGCCTCAGTTTCCTGGGGCTTCAGCAGTAGCGGTGAGGGCTGCTGAGGC TTGCAGATCTGCATTGAAGAATAAAAACTCCAATGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_175360
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC029548, AAH29548
RefSeq Size 2008 bp
RefSeq ORF 1116 bp
Locus ID 108689
UniProt ID Q8K2X3
Cytogenetics 19 C3
Summary Component of the CST complex proposed to act as a specialized replication factor promoting DNA replication under conditions of replication stress or natural replication barriers such as the telomere duplex. The CST complex binds single-stranded DNA with high affinity in a sequence-independent manner, while isolated subunits bind DNA with low affinity by themselves. Initially the CST complex has been proposed to protect telomeres from DNA degradation (PubMed:19854130). However, the CST complex has been shown to be involved in several aspects of telomere replication. The CST complex inhibits telomerase and is involved in telomere length homeostasis; it is proposed to bind to newly telomerase-synthesized 3' overhangs and to terminate telomerase action implicating the association with the ACD:POT1 complex thus interfering with its telomerase stimulation activity. The CST complex is also proposed to be involved in fill-in synthesis of the telomeric C-strand probably implicating recruitment and activation of DNA polymerase alpha (PubMed:22748632). The CST complex facilitates recovery from many forms of exogenous DNA damage; seems to be involved in the re-initiation of DNA replication at repaired forks and/or dormant origins. Required for efficicient replication of the duplex region of the telomere. Promotes efficient replication of lagging-strand telomeres. Promotes general replication start following replication-fork stalling implicating new origin firing. May be in involved in C-strand fill-in during late S/G2 phase independent of its role in telomere duplex replication (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_175360" in other vectors (4)
SKU Description Size Price
MG205901 Obfc1 (tGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1) 10 ug
$657.00
MR205901 Obfc1 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1) 10 ug
$289.00 $457.00
MR205901L3 Lenti ORF clone of Obfc1 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1) 10 ug
$757.00
MR205901L4 Lenti ORF clone of Obfc1 (mGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products