OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ptges2 (NM_133783) Mouse Untagged Clone

Be the first to review this product
SKU
MC205660
Ptges2 (untagged) - Mouse prostaglandin E synthase 2 (Ptges2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA329982 Rabbit Polyclonal Anti-Ptges2 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ptges2 or NM_133783"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ptges2
Synonyms 0610038H10Rik; C79137; Gbf1; Mpges2; Pges2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC004846
GCGCCGGCAGAGCGAACATGGCCCAGGCGGCGCGCCTTTCGTGGGTGCTTGTCTCTAGCCGGTGCGCCCT GACTGAGGGGCTGCTCACACGACCCTGGCAGCCGCTCTCGGCACAGAGCCGGGCTGGCTTCACCAGGGTG GCTGCCGGAAGCCGGGGCGCCGCGGTCCGCAAGGGGAGCCCGCGGTTGCTGGGGGCGGCGGCGCTGGCCC TGGGCGGCGCGCTGGGGCTGTACCACACCGTGCGGTGGCACCAGCGTTCCCAGGACCTCCGCGCGGAGCG CTCGGCTGCGCAGCTGCCCCTGTCGAACAGCCTGCAGCTGACCCTGTACCAGTACAAGACATGTCCCTTC TGCAGCAAAGTCCGTGCCTTCCTCGACTTCCACTCCCTGCCCTATCAGGTGGTGGAGGTGAATCCCGTGA GAAGGACTGAGATCAAATTCTCCTCCTACAGGAAAGTGCCCATCTTGGTGGCCCAGGAAGGAGACAGCTT GCAACAGCTCAATGACTCCTCTGTCATCATTAGTGCCCTCAAGACCTACCTGGTTTCAGGGCAGCCCCTG GAAGAGGTCATCACTTATTACCCACCCATGAAGGCCATGAATGACCAGGGCAAGGAGGTGACCGAGTTTT GCAACAAGTACTGGCCCATGCTGGACGAGAAGGAGGCCCAGCAGATGTATGGCGGGAAGGAAGCCAGGAC GGAGGAGATGAAGTGGCGGCAGTGGGCGGATGACTGGCTGGTGCATCTCATCTCTCCCAACGTGTACCGA ACACCCGCTGAGGCCTTGGCTTCCTTCGACTACATTGTCCGTGAGGGCAAGTTTGGGGCTGTGGAGGCTG CCATGGCCAAGTATGTGGGCGCGGCTGCCATGTACCTCATCAGCAAGCGCCTCAAAAGCAGGCACCACCT GCAGGATGATGTACGGGTAGACCTCTATGAAGCAGCCAACAAGTGGGTGACAGCCGTGGGTAAAGACCGG CCATTCATGGGGGGTCAGAAGCCTAACCTTGCTGACCTGGCAGTGTATGGTGTGCTGCGAGTGATGGAGG GTCTGGAGGCCTTCGACGACCTGATGCGACACTCACACATCCAGCCTTGGTACCTGCGGATGGAGCGGGC CATTGAAGAAGCCCCCTCGGTGCATCATGTCAACCCTAGCTGCAAAGACTAGTTGCTAGGGACACAAGAC CTGGACCAGCCCCTGGCTGTGCTCACAGAGGGCAGAGTCATTTTGTCTCTGGTCCACCTAGCCCCCAGTT CTCTGCTTCTGATACTGGACATTTCTAGGGCCCTTGACGCTGAGGACAAGGCCCAAACTTACAGCTGTTC TGTGGGTAAAGGGTCTGGGGTCTCAAAGGCCTACCCTTCAACCCCAGTTCAGAGGCCTGGTCCCCTAACA GGGACTCCTTTTCAACTCTGCTAGGGCCAAGTCCCTTGTTGACAGGGATCAGACTGGCTCCTGCCCTGGA GGAGGGGAAGGCAGTGTGTTAACAAAGCCCCGCCCACATGCCTCCAGGTTTCAGCTCTTCGAAGGTGCCC CTGGGACTATTGTATTTGTAATAAAGGAGAGGTCTGCCACCCCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_133783
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC004846, AAH04846
RefSeq Size 1598 bp
RefSeq ORF 1155 bp
Locus ID 96979
UniProt ID Q8BWM0
Cytogenetics 2 B
Summary The protein encoded by this gene is a Golgi membrane-associated prostaglandin E synthase candidate, which is capable of catalyzing the conversion of prostaglandin H2 to prostaglandin E2 in vitro. However, a study using mice deficient of this gene suggests that this enzyme does not contribute to prostaglandin E2 biosynthesis in vivo. This protein is synthesized as a Golgi membrane-bound protein, but its N-terminal hydrophobic region is cleaved off during protein maturation to produce the predominant soluble truncated form that still retains the enzyme activity. This soluble protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE), possibly via an interaction with CAAAT/enhancer-binding protein-beta. provided by RefSeq, Oct 2009
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_133783" in other vectors (4)
SKU Description Size Price
MG205997 Ptges2 (tGFP-tagged) - Mouse prostaglandin E synthase 2 (Ptges2) 10 ug
$657.00
MR205997 Ptges2 (Myc-DDK-tagged) - Mouse prostaglandin E synthase 2 (Ptges2) 10 ug
$289.00 $457.00
MR205997L3 Lenti ORF clone of Ptges2 (Myc-DDK-tagged) - Mouse prostaglandin E synthase 2 (Ptges2) 10 ug
$757.00
MR205997L4 Lenti ORF clone of Ptges2 (mGFP-tagged) - Mouse prostaglandin E synthase 2 (Ptges2) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products