Agrp (NM_007427) Mouse Untagged Clone

SKU
MC205250
Agrp (untagged) - Mouse agouti related protein (Agrp), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Agrp
Synonyms Ag; Agrt; Art
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC079902
CGGCCTGAAAGCTTTGTCCTCTGAAGCTGTATGCCCACCGGGGGAACAGTGTTTTCTGCTCCCTTGGTTT CCAGGAACCTTAGGGAGGCACCTCATGCCCTGGCTACAGGAAGCAGTCACGTGTGGACCCTTTATTAGGC ACTGCCATATAAGCTCAGGGCACAAGAGACCAGGACATCCCTAGGCAAAGATCAGCAAGCAAAGGCCATG CTGACTGCAATGTTGCTGAGTTGTGTTCTGCTGTTGGCACTGCCTCCCACACTGGGGGTCCAGATGGGCG TGGCTCCACTGAAGGGCATCAGAAGGCCTGACCAGGCTCTGTTCCCAGAGTTCCCAGGTCTAAGTCTGAA TGGCCTCAAGAAGACAACTGCAGACCGAGCAGAAGAAGTTCTGCTGCAGAAGGCAGAAGCTTTGGCGGAG GTGCTAGATCCACAGAACCGCGAGTCTCGTTCTCCGCGTCGCTGTGTAAGGCTGCACGAGTCCTGCTTGG GACAGCAGGTACCTTGCTGCGACCCGTGCGCTACGTGCTACTGCCGCTTCTTCAATGCCTTTTGCTACTG CCGCAAGCTGGGTACGGCCACGAACCTCTGTAGTCGCACCTAGCCAATGGATGTTGTTTGGGCAAAGGCA GGGGATGAGAATAAAGGATGGGACGGTTTAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI |
ACCN NM_007427
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC079902, AAH79902
RefSeq Size 685 bp
RefSeq ORF 396 bp
Locus ID 11604
UniProt ID P56473
Cytogenetics 8 D3
Summary This gene encodes a protein that regulates feeding behavior and plays a key role in the control of body weight. The encoded protein acts as an antagonist of melanocortin receptor signaling. Alternatively spliced transcript variants have been observed for this gene. provided by RefSeq, Nov 2012
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007427" in other vectors (4)
SKU Description Size Price
MG200748 Agrp (tGFP-tagged) - Mouse agouti related protein (Agrp) 10 ug
$350.00
MR200748 Agrp (Myc-DDK-tagged) - Mouse agouti related protein (Agrp) 10 ug
$289.00
MR200748L3 Lenti ORF clone of Agrp (Myc-DDK-tagged) - Mouse agouti related protein (Agrp) 10 ug
$450.00
MR200748L4 Lenti ORF clone of Agrp (mGFP-tagged) - Mouse agouti related protein (Agrp) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products