OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rp2 (NM_133669) Mouse Untagged Clone

Be the first to review this product
SKU
MC205139
Rp2h (untagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA362955 RP2 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rp2 or NM_133669"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rp2
Synonyms AI662636; Rp2h
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC049698
GGGTTCCTGGCGGCGGGGCTGCTCCCCTGGGCGGTGTCCGGGGAGCTGTTGGCCGAGTCACCCTGGCTTC CCGCCACCCTCTGAAAGGTGTCTGAGCGAGTGGGGTCCACTACCAAGACCCTTAGGCCGCACCATGGGCT GCTGCTTCACTAAGAGGAGGAAGAGTGAAAAGGCTGAGGGAGAGGAGGAGCAGCCCAAGCTGTACAGCTG GGACCAGCGGGAGAAGGTTGATCCAAAAGATTACATGTTTAGTGGACTGAAGGATGAAACAGTAGGTCGC TTACCTGGAAAAGTGGCAGGACAACAATTTGTCATTCAAGACTGTGAGAACTGTAACATCTATATTTTTG ACCACTCAGCTACTATTACCATTGATGACTGCACTAACTGTGTAATTTTTTTGGGACCAGTGAAAGGCAG TGTCTTTTTCCGAAATTGTAGAGATTGCAAGTGCACATTGGCTTGCCAGCAATTTCGTGTGAGAGACTGT AGAAAGTTGGAAGTCTTTTTGTGCTGTGCTACTCAACCCATTATTGAATCTTCCACAAACATCAAGTTTG GCTGTTTTCAATGGTACTACCCTGAATTAGCAGCCCAATTCAAAGATGCAGGCCTCAGTATCTTCAATAA CATTTGGAGTCATGTTCATGATTTTACACCTGTGTCAGGAGAGCTCAACTGGAGCCTTCTTCCAGAAAAT GCCGTGGTTCAAGACTATGTTCCTATCCCAATGACTGAAGAATTCAAAGCTGTGCGAATTTCCACAGAAG CCAATAGAAGCATTGTTCCTGTGTCCCGGGGTCAGAGACAGAAGTACAGTGATGAATCATGTCTTGTGGT ATTATTTGCCGATGATTATACAACTGCAAATGCCAGGAAACTAATTGATGAGATGGTTGGTAAAGGCTTC TCCCTAGTGCAGACAAAGGAAATGTCAATGAAAACTGAAGACGCCCAAAGGGTTTTCCAGGAAAAGGCAT CAGATTTTTTACTTCTTCTAAACAAAGGTCCTGTGATTGCCTTGGAATTTAATGGAGATGACGCTGTACA AGAATGTCACCTTATTGTAAATGGGATGTTCAACGGGACAAAGATGTTTGTATCAGAAAAGAAGGAGACC GCATCTGGAGATGTTGATAGCTTCTATAACTTTGCTGAGATCCAGATGGGGATATGAAGCGGATTGTGGT TCAACAAGTACATTAAGAACATTTGGAGCATTGAGAACAAGCAGAAATGATAACACAATAATAAAATTGC TTCCTGTTGGATATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI |
ACCN NM_133669
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC049698, AAH49698
RefSeq Size 1307 bp
RefSeq ORF 1044 bp
Locus ID 19889
UniProt ID Q9EPK2
Cytogenetics X A1.3
Summary Acts as a GTPase-activating protein (GAP) involved in trafficking between the Golgi and the ciliary membrane. Involved in localization of proteins, such as NPHP3, to the cilium membrane by inducing hydrolysis of GTP ARL3, leading to the release of UNC119 (or UNC119B). Acts as a GTPase-activating protein (GAP) for tubulin in concert with tubulin-specific chaperone C, but does not enhance tubulin heterodimerization. Acts as guanine nucleotide dissociation inhibitor towards ADP-ribosylation factor-like proteins.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_133669" in other vectors (4)
SKU Description Size Price
MG205240 Rp2h (tGFP-tagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h) 10 ug
$657.00
MR205240 Rp2h (Myc-DDK-tagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h) 10 ug
$289.00 $457.00
MR205240L3 Lenti ORF clone of Rp2h (Myc-DDK-tagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h) 10 ug
$757.00
MR205240L4 Lenti ORF clone of Rp2h (mGFP-tagged) - Mouse retinitis pigmentosa 2 homolog (human) (Rp2h) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products