Chchd10 (NM_175329) Mouse Untagged Clone

SKU
MC204970
Chchd10 (untagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 10 (Chchd10), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Chchd10
Synonyms 1620401E04Rik; AI267078; Ndg2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC061190
GACTCTAAGGACGCTGCCGTGTTAGTTGCCCGGCACTGAGCGAGCGGCTGCTACGGTCCACGCTTCTTAC TCAGCTCCAACTTGATCCCACCGCAGTCATGCCTCGGGGAAGCCGCAGTGCGGCTGCCAGGCCGGTCAGC CGCCCAGCCCCGCCTCCTGCGCACCCACCACCCTCAGCGGCCGCCCCGGCACCTGCCGCTCCCGGCCAGC CGGGTCTTATGGCTCAGATGGCATCCACCGCCGCAGGCGTAGCCGTGGGCTCAGCTGTAGGGCATGTCAT GGGTAGCGCCCTGACCAGTGCCTTCAGTGGGGGAAATTCAGAGCCTGCCCAGCCTGCCGTCCAGCAGGCC CCTGCCCGGCCTGCCTCTCACCCCCTGCAGATGGGGCCCTGCTCCTATGAGATCAAGCAGTTCCTGGACT GCTCCACCACTCAGAGCGACCTAACCCTGTGTGAGGGCTTCAGCGAGGCCCTCAAACAGTGCAAATACAA TCACGGTCTGAGCTCCCTGCCCTGAAGAGGCTGTGGGCCTGCTCATCGCCTAACCCCTCACCGACAGCTT GATGGAAAGGAGAGGTTCCATGTGACTGGGAGTAAGGAAGGATCGTTCTCACCCCGCAGACTAACAGGAG ACATAATTATTCAATTAAAAAGTTTACTTTAGACCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI |
ACCN NM_175329
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC061190, AAH61190
RefSeq Size 697 bp
RefSeq ORF 417 bp
Locus ID 103172
Cytogenetics 10 C1
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_175329" in other vectors (4)
SKU Description Size Price
MG200858 Chchd10 (tGFP-tagged) - Mouse Nur77 downstream gene 2 (Ndg2) 10 ug
$350.00
MR200858 Chchd10 (Myc-DDK-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 10 (Chchd10) 10 ug
$289.00
MR200858L3 Lenti ORF clone of Chchd10 (Myc-DDK-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 10 (Chchd10) 10 ug
$450.00
MR200858L4 Lenti ORF clone of Chchd10 (mGFP-tagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 10 (Chchd10) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products