OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Eif3i (NM_018799) Mouse Untagged Clone

Be the first to review this product
SKU
MC204531
Eif3i (untagged) - Mouse eukaryotic translation initiation factor 3, subunit I (Eif3i), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Eif3i or NM_018799"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Eif3i
Synonyms 36kDa; D4Ertd632e; Eif3s2; Trip1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC029625
AGGATGAAACCCATCCTGCTGCAGGGCCATGAGCGGTCCATCACGCAGATCAAGTATAACCGCGAAGGAG ACCTCCTCTTCACCGTGGCCAAAGACCCTATCGTCAACGTGTGGTACTCTGTCAATGGGGAGAGGCTAGG CACCTACATGGGCCACACTGGAGCTGTGTGGTGCGTGGATGCTGACTGGGACACCAAGCATGTCCTTACT GGCTCAGCTGACAACAGCTGTCGTCTCTGGGACTGTGAAACAGGGAAGCAGCTGGCCCTACTCAAGACCA ACTCAGCTGTCCGGACCTGCGGCTTTGACTTTGGGGGCAACATCATCATGTTCTCCACAGACAAGCAGAT GGGGTATCAGTGCTTTGTGAGCTTCTTTGATCTGCGGGATCCAAGCCAGATCGACAGCAACGAGCCCTAC ATGAAGATCCCCTGTAATGATTCCAAGATCACCAGTGCCGTCTGGGGCCCCCTCGGGGAGTGCGTCATCG CAGGCCACGAGAGCGGAGAGCTCAACCAGTATAGCGCCAAGTCTGGAGAGGTGTTGGTGAACGTAAAGGA ACACTCTCGGCAGATCAATGACATCCAGTTGTCTAGAGACATGACCATGTTTGTCACTGCATCTAAGGAC AACACAGCTAAGCTCTTCGACTCCACGACTCTTGAACATCAGAAGACTTTCCGAACAGAGCGTCCTGTCA ACTCGGCTGCTCTCTCTCCCAACTATGACCATGTGGTGCTGGGAGGAGGTCAGGAAGCCATGGATGTGAC CACAACCTCCACCAGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCTTTTGAGGAAGAGTTTGGA AGAGTCAAGGGCCACTTTGGACCGATCAACAGCGTTGCCTTCCATCCTGATGGCAAGAGCTACAGCAGCG GTGGCGAAGATGGTTACGTCCGCATCCACTACTTCGACCCACAGTACTTTGAGTTCGAGTTTGAGGCCTA AGTTCTGGGTCTCCATCCACAACAGAGAAGCTGCTCACAGAAGGTTTTAGACTGAGAAATAAATTAGTTT GTTAAAAATAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_018799
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC029625, AAH29625
RefSeq Size 1082 bp
RefSeq ORF 978 bp
Locus ID 54709
UniProt ID Q9QZD9
Cytogenetics 4 63.26 cM
Summary Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018799" in other vectors (4)
SKU Description Size Price
MG204729 Eif3i (tGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 2 (beta) (Eif3s2) 10 ug
$500.00
MR204729 Eif3i (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit I (Eif3i) 10 ug
$289.00 $300.00
MR204729L3 Lenti ORF clone of Eif3i (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit I (Eif3i) 10 ug
$600.00
MR204729L4 Lenti ORF clone of Eif3i (mGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit I (Eif3i) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products