OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ppid (NM_026352) Mouse Untagged Clone

Be the first to review this product
SKU
MC204530
Ppid (untagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA363177 PPID Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ppid or NM_026352"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ppid
Synonyms 4930564J03Rik; CYP-40; Ppidl; Ppif
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC019778
GTTATAACGTAGAGGGGCAGTAGAGTTTGCTCCGGTCTCGCGCACGAGGTGCTCGTGTCCCGCTGCCCAG TGCCCGCAGTGAAGATGTCCCACGCATCCCCGGCAGCCAAGCCCTCCAACTCCAAGAACCCGCGAGTCTT CTTTGACGTGGACATCGGCGGGGAGCGAGTTGGCCGAATTGTTTTAGAATTGTTTGCAGATATTGTTCCC AAAACTGCAGAAAATTTTCGTGCGTTGTGTACAGGAGAAAAAGGAACTGGGTCCACGACCGGGAAGCCTC TCCATTTTAAAGGATGCCCTTTCCACCGAATTATTAAGAAATTTATGATTCAGGGTGGAGACTTCTCAAA TCAGAATGGGACAGGTGGCGAAAGTATTTATGGTGAAAAATTTGAAGATGAAAATTTTCATTATAAGCAT GATCGGGAGGGTTTGCTGAGCATGGCAAATGCAGGCCCCAATACGAATGGCTCTCAGTTCTTTATCACAA CAGTTCCGACTCCTCATCTGGACGGGAAACATGTGGTATTTGGTCAGGTCATAAAAGGACTAGGTGTGGC AAGGACGCTTGAAAATGTAGAGGTGAATGGTGAAAAACCTGCCAAACTCTGTGTTATTGCAGAATGTGGA GAATTGAAAGAAGGGGATGACTGGGGAATCTTCCCCAAAGATGGCTCTGGTGACAGTCATCCAGACTTCC CTGAGGATGCAGATATAGATTTAAAAGATGTAGATAAAATTTTATTAATATCTGAAGACTTAAAAAACAT TGGAAATACTTTTTTCAAGTCTCAGAACTGGGAGATGGCTATTAAAAAATATGCGAAGGTTTTAAGGTAT GTGGATAGTTCAAAGGCTGTTATTGAGAAAGCAGATAGATCCAGACTGCAACCTATAGCCTTAAGTTGTG TGCTGAATATTGGTGCTTGTAAGCTGAAGATGTCAAATTGGCAGGGGGCAATTGACAGTTGCTTAGAGGC TCTTGAAATGGACCCTTCAAATACTAAAGCACTATACCGAAAAGCGCAAGGATGGCAAGGATTGAAAGAA TATGATCAAGCATTGGCTGATCTTAAGAAGGCACAGGAGATAGCCCCAGGAGATAAAGCTATCCAGGCAG AATTGCTTAAAGTCAAACAAATGATAAAGGCACAGAAAGATAAAGAGAAGGCCGTGTATGCAAAAATGTT TGCTTAATAATGATTAAACTCTCTTTAACTATTATACATTGATTATCTAAAGGACAAGGTATATTACTGT CTACATGCTCCCTGTTGTGTTTCCCTTGATCTCTGTCATTGTTTACATAGCAGTGCTGACACAGGTTCCT TCTTAATAAAGAGTTAAAAAATACAGTGAATCTCATTTTAAAATGTTTGTCTGCATTTTCACCAAGAGTG TATCTGGCCAATGTTTAAACTCTAACTCTCACTAAATTTTCGGCTTTGTGGATGGTCTAGCCCAGCAGTT CTTAACCTGATGGTCCACTGAAAAACATAGATATTTTTACAGTATGGTTCAGAGCAGTAGCAAAATTACA GTTGTGAAGTAGCAACAAAAATAAATTTATGTTTGGGGGTCACCACATGAAGAACTGTACTAAAAGGTTG CAGCACTAGTAAGGTTGGGAACCACTGATGTAACTGTCACGTTTATGTGTATTAACCAGCTATGTGTATA AACCATCGGGCATGGCTGTGTTTCAATAAATCGGTTTTTAAGTGTTCAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_026352
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC019778, AAH19778
RefSeq Size 1813 bp
RefSeq ORF 1113 bp
Locus ID 67738
UniProt ID Q9CR16
Cytogenetics 3 E3
Summary PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity region. Involved in regulation of UV radiation-induced apoptosis.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_026352" in other vectors (6)
SKU Description Size Price
MG205715 Ppid (tGFP-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$657.00
MR205715 Ppid (Myc-DDK-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$289.00 $457.00
MR205715L1 Lenti ORF clone of Ppid (Myc-DDK-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$757.00
MR205715L2 Lenti ORF clone of Ppid (mGFP-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$757.00
MR205715L3 Lenti ORF clone of Ppid (Myc-DDK-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$757.00
MR205715L4 Lenti ORF clone of Ppid (mGFP-tagged) - Mouse peptidylprolyl isomerase D (cyclophilin D) (Ppid) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products