Cyb561d2 (NM_019720) Mouse Untagged Clone

SKU
MC204508
Cyb561d2 (untagged) - Mouse cytochrome b-561 domain containing 2 (Cyb561d2), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cyb561d2
Synonyms AW049681; Tsp10
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC027212
CCGTAACGGAGCGGTGGCGCGGCTGGCGGGGCCGAGGGTCCAGTTTATTTTGGAGGAAGTCACTGCGTCG AACCTGAGAAGCAGGCTGTGCAGCTATCGGCTGGGCTGACCATGGCCCTTTCTGTGGAGACGGAGTCGCA TATCTACCGAGCTCTGCGCACTGCCTCTGGGGCTGCAGCCCACCTCGTGGCGTTAGGCTTTACCATCTTT GTTGCTGTGCTTGCCAGACCTGGCTCCAGTCTGTTCTCCTGGCACCCCGTTCTTATGTCTCTGGCTTTCT CCTTCCTGATGACCGAGGCACTCCTGATGTTCTCTCCTGAGAGTTCCCTGCTGCGGTCCCTCTCTCGGAA GGTCCGCGCACGCTGCCACTGGGTGCTCCAGCTGCTGGCCCTACTCTGTGCTCTGCTGGGTCTAGGTCTT GTCATCCTCCACAAAGAGCAGCTTGGCAAAGCACACCTGACCACTCGGCATGGGCAGGCAGGGCTGTTAG CTGTGCTGTGGGCAGGTCTGCAGTGTTCAGGGGGCATGGGGCTGCTCTACCCCAAGTTGCTGCCCCGATG GCCCCTGGCAAAGTTGAAACTCTACCACGCCACTTCTGGGTTGGTGGGCTACCTGCTGGGCAGTGCCAGC CTCCTGTTGGGCATGTTCTCACTCTGGTTCACTGCCACTGTCACTGGTGGTGCCTGGTACCTGGCTGTGT TGTGCCCCATCCTCACCAGTTTGGTAATCATGAACCAAGTGAGCAATGCCTACCTGTACCGCAAGAGGAT CCAGCCATGAGCACTCACCAGTTATTACGAAGGCTGGATTTGCACCTCAGCTTCGGACCAGGAGCTCGGA ACCTGTTGGACTCTCACAACTGACAGGGTCTGGGGACATTTCAGGGACTAGGGCACTCAGGGGTAGATCT CCTCACACTAGAGTGTCTCCCTTTTCTTGCTGTCAACCCAGGGGAGCATGGTCATGTGTCTGGGTGAAGT TGGAGTTGCAACAGTCTCCCCAGCAGCCATACAGCTTATATTTGTACTGGTATGTCCAGAAATCATGGAG GAAAGAAAAGTAAAATAAACAAACAGAATCCTGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_019720
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC027212, AAH27212
RefSeq Size 1098 bp
RefSeq ORF 669 bp
Locus ID 56368
UniProt ID Q9WUE3
Cytogenetics 9 F1
Summary Two-heme-containing cytochrome that catalyzes ascorbate-dependent trans-membrane ferric-chelate reduction.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019720" in other vectors (4)
SKU Description Size Price
MG202569 Cyb561d2 (tGFP-tagged) - Mouse cytochrome b-561 domain containing 2 (Cyb561d2) 10 ug
$500.00
MR202569 Cyb561d2 (Myc-DDK-tagged) - Mouse cytochrome b-561 domain containing 2 (Cyb561d2) 10 ug
$289.00 $300.00
MR202569L3 Lenti ORF clone of Cyb561d2 (Myc-DDK-tagged) - Mouse cytochrome b-561 domain containing 2 (Cyb561d2) 10 ug
$600.00
MR202569L4 Lenti ORF clone of Cyb561d2 (mGFP-tagged) - Mouse cytochrome b-561 domain containing 2 (Cyb561d2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products