Psmc3ip (NM_008949) Mouse Untagged Clone

SKU
MC204035
Psmc3ip (untagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Psmc3ip
Synonyms C79099; GT198; HOP2; Tbpip
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030169
CCACGCGTCCGCTCGAGTTTGGTGGCGAGAAAGGCCATGAGTAAAAGCCGGGCCGAGGCTGCGGCTGGAG CCCCCGGGATCATCCTGAGGTACCTGCAAGAACAAAACCGGCCCTACAGCGCCCAGGACGTGTTCGGAAA CCTACAGAAGGAACATGGACTGGGCAAGGCGGCGGTAGTGAAGGCGCTGGATCAGCTGGCCCAGGAAGGC AAGATCAAAGAGAAGACCTACGGCAAGCAGAAAATTTATTTTGCCGATCAGAACCAGTTTGACACAGTGA GTGATGCGGACCTCCACGGCCTGGATGCCAGTATCGTGGCCCTCACTGCCAAGGTGCAGAGCTTACAGCA GAGCTGCCGACACATGGAGGCCGAGCTGAAGGAATTAACAAGTGCGCTGACCACTCCTGAGATGCAGAAA GAGATTCAGGAGTTAAAGAAGGAGTGTGCTCAATACACAGAGAGACTGAAGAACATCAAAGCAGCTACCA ACCATGTCACTCCAGAAGAGAAGGAGAAGGTGTACAGAGACAGACAGAAGTACTGTAAAGAGTGGAGGAA GCGGAAGAGGATGACCACAGAGCTGTGTGATGCGATCCTTGAAGGCTACCCCAAGAGCAAGAAGCAGTTC TTTGAGGAAGTTGGAATAGAGACAGATGAAGATCATAATGTTTTGCTCCCCGACCCCTGAGGGGCCCTTG GTGGAGGTGGGAACAGAGCGTCCTGCGCTGGCCACCTTACTTAGTGGCCTTTTTATTCTTGCTGTTCTCC ACCTTTGAGCAGTGGACGGAGCACAAAGCCATAGTGTTAGATAGAGGCTGGTGATCAGAAAGGACGGTCA TGTCCGTTTTGTACAGGCCTCAACAAGGACTTAAAACAATCCTAAAAGAAAGTATTTGTAATATTTATTG TAATATAATTTGATATAAAAATAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_008949
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030169, AAH30169
RefSeq Size 948 bp
RefSeq ORF 654 bp
Locus ID 19183
UniProt ID O35047
Cytogenetics 11 D
Summary Plays an important role in meiotic recombination. Stimulates DMC1-mediated strand exchange required for pairing homologous chromosomes during meiosis. The complex PSMC3IP/MND1 binds DNA, stimulates the recombinase activity of DMC1 as well as DMC1 D-loop formation from double-strand DNA. This complex stabilizes presynaptic RAD51 and DMC1 filaments formed on single strand DNA to capture double-strand DNA. This complex stimulates both synaptic and presynaptic critical steps in RAD51 and DMC1-promoted homologous pairing. May inhibit HIV-1 viral protein TAT activity and modulate the activity of proteasomes through association with PSMC3.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008949" in other vectors (4)
SKU Description Size Price
MG202419 Psmc3ip (tGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) 10 ug
$500.00
MR202419 Psmc3ip (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) 10 ug
$289.00 $300.00
MR202419L3 Lenti ORF clone of Psmc3ip (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) 10 ug
$600.00
MR202419L4 Lenti ORF clone of Psmc3ip (mGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein (Psmc3ip) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products