Dcps (NM_027030) Mouse Untagged Clone

SKU
MC203955
Dcps (untagged) - Mouse decapping enzyme, scavenger (Dcps), (10ug)
  $457.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dcps
Synonyms 1700001E16Rik; AA408441
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC016273
GCTTCTTCGTGCAGGCGGGTACGGTTCTTCCCAGGCAGCATGGCGGATACAGCGCCTCAACTCAAGAGAA AGCGCGAACAGGAGGCAGAGGAGGCAGAAACCCCCAGCACAGAGGAGAAGGAAGCAGGCGTTGGCAATGG CACCTCTGCCCCTGTCCGCTTACCGTTCTCCGGCTTTAGAGTACAAAAAGTGCTCAGGGAGTCTGCGCGG GACAAAATTATTTTCCTGCATGGGAAGGTGAATGAGGACTCTGGGGATACTCATGGAGAAGATGCGGTTG TGATCCTGGAGAAGACACCATTTCAGGTAGAACACGTGGCGCAGCTCCTAACGGGGAGCCCTGAGCTCAA GTTGCAGTTCTCCAATGATATCTACAGCACCTATAACCTGTTTCCTCCAAGGCATCTGAGTGATATAAAA ACAACTGTGGTGTACCCTGCCACAGAGAAACACCTGCAAAAATACATGCGTCAGGACCTCCGCCTGATCC GAGAGACTGGAGATGACTACAGGACCATCACCTTACCCTACCTGGAATCCCAGAGCCTTAGCATCCAGTG GGTGTATAACATTCTTGACAAGAAGGCTGAAGCTGACCGGATTGTTTTTGAGAACCCAGACCCTTCTGAT GGCTTTGTCCTCATCCCAGACCTCAAGTGGAACCAGCAGCAGCTTGATGACCTGTATTTGATCGCCATCT GCCATCGCCGGGGTATCAGATCACTTCGAGATCTCACTCCAGAGCATCTGCCACTACTGAGGAACATTCT CCGGGAAGGACAAGAAGCCATCCTGAAGCGCTACCAGGTGACAGGAGACCGTCTGCGAGTGTACCTACAC TACCTGCCCTCTTACTATCACCTGCACGTGCATTTCACAGCTCTGGGCTTCGAGGCTCCGGGCTCAGGGG TGGAGCGGGCACACCTGCTGGCTCAAGTGATCGAGAACCTGGAGTGTGACCCCAAGCACTATCAACAGCG CACTCTTACTTTTGCCCTCAGGACCGATGACCCCCTGCTTCAGCTCCTGCAGAAGGCCCAGCAAGAGAGG AACTAGTGGGTCGGGCCTGGGGTAGTGTGGGCTGGGTTTTTATCTCTAAGGGATTTCCCTAAAATGCATT TTGTAGTTTCTCGGCCTTTCAGCAAAGGTCAAGTGTAAGATGTTTTTTTGTACTGGTTTATTCCTCACAT GAGAATAAAGAACTTTCTGATTGGAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_027030
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC016273, AAH16273
RefSeq Size 1240 bp
RefSeq ORF 1017 bp
Locus ID 69305
UniProt ID Q9DAR7
Cytogenetics 9 A4
Summary Decapping scavenger enzyme that catalyzes the cleavage of a residual cap structure following the degradation of mRNAs by the 3'->5' exosome-mediated mRNA decay pathway. Hydrolyzes cap analog structures like 7-methylguanosine nucleoside triphosphate (m7GpppG) with up to 10 nucleotide substrates (small capped oligoribonucleotides) and specifically releases 5'-phosphorylated RNA fragments and 7-methylguanosine monophosphate (m7GMP). Cleaves cap analog structures like tri-methyl guanosine nucleoside triphosphate (m3(2,2,7)GpppG) with very poor efficiency. Does not hydrolyze unmethylated cap analog (GpppG) and shows no decapping activity on intact m7GpppG-capped mRNA molecules longer than 25 nucleotides. Does not hydrolyze 7-methylguanosine diphosphate (m7GDP) to m7GMP. May also play a role in the 5'->3 mRNA decay pathway; m7GDP, the downstream product released by the 5'->3' mRNA mediated decapping activity, may be also converted by DCPS to m7GMP. Binds to m7GpppG and strongly to m7GDP. Plays a role in first intron splicing of pre-mRNAs. Inhibits activation-induced cell death.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027030" in other vectors (4)
SKU Description Size Price
MG205053 Dcps (tGFP-tagged) - Mouse decapping enzyme, scavenger (Dcps) 10 ug
$657.00
MR205053 Dcps (Myc-DDK-tagged) - Mouse decapping enzyme, scavenger (Dcps) 10 ug
$289.00 $457.00
MR205053L3 Lenti ORF clone of Dcps (Myc-DDK-tagged) - Mouse decapping enzyme, scavenger (Dcps) 10 ug
$757.00
MR205053L4 Lenti ORF clone of Dcps (mGFP-tagged) - Mouse decapping enzyme, scavenger (Dcps) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products