OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cngb1 (NM_145601) Mouse Untagged Clone

Be the first to review this product
SKU
MC203951
Cngb1 (untagged) - Mouse cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cngb1 or NM_145601"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cngb1
Synonyms Cngb1b; Garp2; Gm1959
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC016201
AGCTGCTGGGGCACTGAGAAGGCAATTCCTGGCTAGCCGCTGACATCTGAACAGGTGTCAGGATGTTGGG CTGGGTCCAAAGGGTGCTGCCTCAGCCTCCGGGGACCCCTCAGAAGACCGTGGAGACAGCAGGACCACAG CCAGAAACAGAGTCGAAACCAGAGGCCAACCCACAACCGGAGCCAGAACCTCAGCAGGAACCAGAGCCAG AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAACCTGAACC TGAACCAGTACCTGAAGAGGCTCCACCTGAGGTCCAGGCCCTGCCACCAGAGGAGCCAATGGAAGGAGAG GGAGAGGCTGAGGCTGGTCCCAGCCTTCAAGAGACCCAGGTAGCTGACCCTGCTCAGCCCACCTCCCAGG CCCAGGTTGCTGTTGCCAAGGTGAACAGGCCCAGCTCCTGGATGTTGAGCTGGTTCTGGAGAGGCATGCA GAAGGTCGTGCCACAGCCTGTCTGCAGCAATGGGGGCCAGAACCTGGCTGCCGGAGAGCGAGACCCAGAT CAGGGTGGAGCACAGATCCCAGAACCTTGTGGCACTGGGGACCCAGGATCTGCAGAAGCTTCCGGGACTC AGGACACTGAGCCCAGCCTTTGGCTGCTCAGGTGGCTTGAGCAGAATCTGGAAAAAGTGCTGCCCCAGCC CCCTCCGCCTTCCCTGGCCTGGAAAGTTGAACCTGAGGCTGCTGTCTTGGATCCAGATCCTCCAGGAACC CCTATGCAGATGGAGCCCACAGAGAGCCCCTCCCAGCCTAATCCTGGACCCCTGGAGCCTGAGGAAGAGC CAGCTGCAGAGCCCCAGCCTGGCTTCCAATCCTCTTCCCTGCCACCACCCGGGGACCCCGTCAGGCTGAT TGAGTGGCTCCTACACAGACTGGAGATGGCCCTGCCTCAGCCCGTGCTCCATGGGAAGGCTGCAGAGCAA GAGCCTGGCTGCCCTGGGATGTGTGACGTACAGACCAGGGCGACAGCAGCTGGAGGCCTCTGAAACAAGG GAGAGGGGACCTGGGGAGCCCATGGACAAACGGATGCATGGATGGATGAAGGACTGAAGGATGCCTCAAG AGAAGAACTTTAGGGGGCAGTGACTGCTAATCTCCACCCTCTTTGAATAGTGAGCCCCCTGCACCCCCAG GCAGGGCAGAGGAAACCAGAGTCATTAAGTGTAACCCCAGAGCTTCCTCTCAGGGCTCTTGGGCAGGGGG CAGCACCCAGATCAGGGCAAGGGCAAGGAAGACTTCCTGGTGTGAGACTACAGAGAGCCCTCCCTATTGA GGCCTCAGTGTCTGAGCATGCTCTCACAAGGGGAACCTGGCACCATCCACACTACACGGGACTCAGTTTC CCTATAAGTGGTTCTTCCAAGGCCTGCCCTAGTTCTCTCTCCCAAGAGTGAGGGACCACCACCGACTGTG ACATTGTAATTGACATTAAAGAGTGTGACTTTGCACCTCAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_145601
Insert Size 981 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC016201, AAH16201
RefSeq Size 1528 bp
RefSeq ORF 981 bp
Locus ID 333329
Cytogenetics 8 C5
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145601" in other vectors (5)
SKU Description Size Price
MC207962 Cngb1 (untagged) - Mouse cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2, (10ug) 10 ug
$480.00
MG204775 Cngb1 (tGFP-tagged) - Mouse cDNA sequence BC016201 (BC016201) 10 ug
$650.00
MR204775 Cngb1 (Myc-DDK-tagged) - Mouse cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2 10 ug
$450.00
MR204775L3 Lenti ORF clone of Cngb1 (Myc-DDK-tagged) - Mouse cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2 10 ug
$750.00
MR204775L4 Lenti ORF clone of Cngb1 (mGFP-tagged) - Mouse cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products