OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ubl4a (NM_145405) Mouse Untagged Clone

Be the first to review this product
SKU
MC203830
Ubl4 (untagged) - Mouse ubiquitin-like 4 (Ubl4), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ubl4a or NM_145405"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ubl4a
Synonyms DXHXS254E; DXS254E; DXS254Eh; Gdx; Ubl4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010817
GGCGGCGCGCGGCAGGGGACCGTTGGTGTTTGCGTTGGCCGTAGTGGACTGGGCCGTGGACACCATGCAG CTGACCGTGAAGGCGCTCCAGGGCCGGGAATGTAGCCTACAGGTGGCGGAGGACGAGCTAGTGTCTACAC TGAAGCACCTGGTCTCGGATAAGCTGAATGTCCCTGTGCGCCAGCAACGTCTGCTGTTCAAGGGCAAGGC CCTAGCAGATGAAAAACGACTGTCAGATTACAACATTGGGCCCAATTCTAAGCTCAACCTAGTTGTTAAG CCTTTGGAGAAGGTGCTACTGGAAGAAGGGTCTGCCCACAGACTGGTCGACTCCCCAGCCACCCCCATCT GGCAGCTGATCTCCAAAGTCCTGGCCCGTCACTTCAGTGTAGCAGATGCCAGCAGGGTCCTGGAACAACT ACAGAGGGATTATGACAGGTCCTTGAGCCGCCTAACACTGGATGACATCGAACGTTTGGCCAGCCGCTTT CTACACCCTGAAGTGACTGAGGCTATGGAAAAAGGGTTCTGCAAATAGCATTCTGGGATTGTGGGGAGAA ATCCCAGGTCAGGCCACAGCTGCATGTTGCATTAAATGTGTTCTCATGTCGCAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_145405
Insert Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010817, AAH10817
RefSeq Size 629 bp
RefSeq ORF 474 bp
Locus ID 27643
UniProt ID P21126
Cytogenetics X 38.0 cM
Summary As part of a cytosolic protein quality control complex, the BAG6/BAT3 complex, maintains misfolded and hydrophobic patches-containing proteins in a soluble state and participates to their proper delivery to the endoplasmic reticulum or alternatively can promote their sorting to the proteasome where they undergo degradation. The BAG6/BAT3 complex is involved in the post-translational delivery of tail-anchored/type II transmembrane proteins to the endoplasmic reticulum membrane. Recruited to ribosomes, it interacts with the transmembrane region of newly synthesized tail-anchored proteins and together with SGTA and ASNA1 mediates their delivery to the endoplasmic reticulum. Client proteins that cannot be properly delivered to the endoplasmic reticulum are ubiquitinated and sorted to the proteasome. Similarly, the BAG6/BAT3 complex also functions as a sorting platform for proteins of the secretory pathway that are mislocalized to the cytosol either delivering them to the proteasome for degradation or to the endoplasmic reticulum. The BAG6/BAT3 complex also plays a role in the endoplasmic reticulum-associated degradation (ERAD), a quality control mechanism that eliminates unwanted proteins of the endoplasmic reticulum through their retrotranslocation to the cytosol and their targeting to the proteasome. It maintains these retrotranslocated proteins in an unfolded yet soluble state condition in the cytosol to ensure their proper delivery to the proteasome.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer, protein-coding transcript.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145405" in other vectors (4)
SKU Description Size Price
MG201186 Ubl4 (tGFP-tagged) - Mouse ubiquitin-like 4 (Ubl4) 10 ug
$350.00
MR201186 Ubl4 (Myc-DDK-tagged) - Mouse ubiquitin-like 4 (Ubl4) 10 ug
$289.00
MR201186L3 Lenti ORF clone of Ubl4 (Myc-DDK-tagged) - Mouse ubiquitin-like 4 (Ubl4) 10 ug
$450.00
MR201186L4 Lenti ORF clone of Ubl4 (mGFP-tagged) - Mouse ubiquitin-like 4 (Ubl4) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products