OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rbm3 (NM_016809) Mouse Untagged Clone

Be the first to review this product
SKU
MC203679
Rbm3 (untagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA356086 Rbm3 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rbm3 or NM_016809"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rbm3
Synonyms 2600016C11Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC006580
CTCGTCGTCTCTGCTGTCCTCTGACTTTTAATTTCCAGGACTTGCCTTCTGCCATGTCGTCTGAAGAAGG GAAACTCTTCGTAGGAGGGCTCAACTTCAACACCGATGAACAGGCACTTGAAGACCACTTCAGCAGCTTT GGGCCTATCTCTGAGGTGGTTGTTGTCAAGGACCGGGAGACTCAAAGATCCCGGGGTTTTGGCTTCATCA CCTTCACAAACCCAGAGCATGCCTCAGATGCGATGAGAGCCATGAATGGAGAGTCCCTGGATGGGCGCCA AATCCGAGTTGATCATGCAGGAAAGTCTGCCAGGGGATCCAGAGGGGGTGCCTTTGGTGGGCGTGGTCGC AGTTACTCTAGAGGTGGTGGAGACCAGGGATATGGAAGTGGAAGATATGACAGTCGTCCTGGAGGATATG GATATGGGTATGGGCGGTCTAGAGACTACAGTGGCAGCCAGGGTGGCTATGACCGCTACTCAGGAGGAAA TTACAGAGACAATTATGACAACTGAGATGGGGCATGCACACAAAATATACACAAGGAATAACACTTCTGA TCCAGGATCGTCCTTGCAAATTGCTGTATTTATAAAGATTTTTGGAGCTGCGCTGAAACGTCTGTTTTAG TACATCAAGTTCTATTTTTGAATTGAGCTCCCAAGGTAGTTTGTTAAAGAACTTTTAGAAAGCTCCATGT GTTCTTTAAACATTTTTTCCCTTTTAAAAACAAATTTTAAGACATTTGTTACAGTCCCAATATTTTTCCT TTTATCAGAATTTTTGTTTAGGCACTCAGGATTATTGTTTCTGGCCAAAAGAAAAAAGTGGCCAGGCTAA ATCAGTTTTTAAAGTTGATGTGTATTTAGGGACATTTTAAAACCTTGTAAACAGAAAGTGATTTCTGAAT GTACCTATGAACAATCCGAGTCAAGATCATGATTGCTTAGAGATGTTTTTTATTAAAGATCACCATCCTG ATTATATAGAAGAGCTTCTTTAAAATGTTTGTGAATGTCATTTTTTAATACTGGAAGAAAAGTATTCTGT TGTGTCTGATGTGTTTAGGATGTCCTTTATGGAGCTAATTAAAAGATGAAACCTGAAAAAAAAAAAAAAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_016809
Insert Size 462 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC006580, AAH06580
RefSeq Size 1133 bp
RefSeq ORF 462 bp
Locus ID 19652
Cytogenetics X 3.68 cM
Summary Cold-inducible mRNA binding protein that enhances global protein synthesis at both physiological and mild hypothermic temperatures. Reduces the relative abundance of microRNAs, when overexpressed. Enhances phosphorylation of translation initiation factors and active polysome formation.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer protein (isoform 1). Variants 1, 2, and 5 encode the same protein (isoform 1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016809" in other vectors (6)
SKU Description Size Price
MG201130 Rbm3 (tGFP-tagged) - Mouse RNA binding motif protein 3 (Rbm3) 10 ug
$489.00
MR201130 Rbm3 (Myc-DDK-tagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1 10 ug
$289.00
MR201130L1 Lenti ORF clone of Rbm3 (Myc-DDK-tagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1 10 ug
$525.00
MR201130L2 Lenti ORF clone of Rbm3 (mGFP-tagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1 10 ug
$525.00
MR201130L3 Lenti ORF clone of Rbm3 (Myc-DDK-tagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1 10 ug
$525.00
MR201130L4 Lenti ORF clone of Rbm3 (mGFP-tagged) - Mouse RNA binding motif protein 3 (Rbm3), transcript variant 1 10 ug
$525.00

file-alt Citations

Cold-shock proteome of myoblasts reveals role of RBM3 in promotion of mitochondrial metabolism and myoblast differentiation
Dey, Rajalaxmi, Saha et al
Commun Biol (2024) 7 (1), 515 DOI: 10.1038/s42003-024-06196-4
Cited by 10
AI Summary: OriGene's RBM3-PUC plasmid (MC203679) was used as the source for cloning the mouse RBM3 gene, enabling the study of RBM3's role in myoblast mitochondrial metabolism and differentiation in this research.
Snippet: g antibiotics. All the experiments of mice primary muscle cells were done by electroporating the cells with pMIG-RBM3 and pMIG-GFP plasmids. Cloning techniques Mouse RBM3 gene from RBM3-PUC plasmid (Origene MC203679) was cloned into pMIG-GFP plasmid by restriction digestion method using Bgl2 and EcoR1. Primers used for cloning (Forward primer: GGAAGATCTTATGTCGTCTGAAGAAGGGAAACTC, Reverse primer: C
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products