OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ube2d3 (NM_025356) Mouse Untagged Clone

Be the first to review this product
SKU
MC203282
Ube2d3 (untagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK DDK
AAV Particle:
DDK DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ube2d3 or NM_025356"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ube2d3
Synonyms 1100001F19Rik; 9430029A22Rik; AA414951
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC057941
CGCGTGAGCCCCGTAGGGCCGGGGAGGCACCAGCTGCCGCGCGGGGAGGAGGCCGAGGCCGCAGCTCGAG GGAGGCCCCGGCCCTCTGCGCCTGTGTCTGGCAGAGCCGGTGTGAGAAGAAGAGACAACCCTTCCCCGCC GCCGGGATAATCAAGAGTTTTGGCCGGACCTTTGAGTACACCTCGGGATAGTGAGGAGCCCGGCGAAAAG CACAGACTATGGCGCTGAAACGGATTAATAAGGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATG TTCTGCAGGTCCAGTTGGAGATGACATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCA TATCAAGGTGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTG CATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTTGATATTCTAAGATC ACAGTGGTCTCCTGCTTTAACTATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAAC CCAGACGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATAT CTCGGGAATGGACTCAGAAGTATGCCATGTGATGCTACCTTACAGTCAGAATAACCTGCATTATAGCTGG AATAAACTTTAAATTACTGTTCCTTTTTTGATTTTCTTATCCGGCTGCTCCCCTATCAGACCTCATCTTT CTTAATTTTATTTTTTGTTTACCTCCCTCCATTCATTCACATGCTCATCTGAGAAGACTTAAGTTCTTCC AGCTTTGGACAATAACTGCTTTTAGAAACTGTAAAGTAGTTACACGAGAACAGTTGCCCAAGATTCAGAA ATTTTTTTAAAAACTGGAGCATGTGTATTATGTGGCCAATGTCTTCACTCTAACTTGGTTATGAGACTAA ACCAATCCTCACTGCTCTAACATGCTGAAGAAGCCATCTGAGGGGGAGGGAGATGGATGCTCAGCTGTCA CATCAAAGGAAGCAGCATTATTCTAGCAGCATCCGTTCTTGTTTAAACCTTCCACTGTTAGAGGTTTGAG GTTACATGATATACTTTATGCTCATAACTGATGTGGCTGGAGAATTGGTATTGAATTATAGCATCAGCAG AACAGAAAATGTGATGTATTTTATGCATGTCAATAAAGGAATGACCTGTTCTTGTTCTACAGAGAATGGA AATTGGAAGTCAAACACCCTTTGTATTCCAAAATAGGGTCTCAAAACATTTTGTAATTTTCATTTAAATT GTTAGGAGGCTTGGAGCTATTAGTTAATCTATCTTCCAATACTGTTTAATATAGCACTGAATAAATGATG CGAGTTGTCAATGGATGAGTGATCAACTAATAGCTCTCCTAGTAATTGATTTATTTTTCTTCAATAAAGT TGCATAAACCAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_025356
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC057941, AAH57941
RefSeq Size 1500 bp
RefSeq ORF 444 bp
Locus ID 66105
UniProt ID P61079
Cytogenetics 3 G3
Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-11'-, as well as 'Lys-48'-linked polyubiquitination. Cooperates with the E2 CDC34 and the SCF(FBXW11) E3 ligase complex for the polyubiquitination of NFKBIA leading to its subsequent proteasomal degradation. Acts as an initiator E2, priming the phosphorylated NFKBIA target at positions 'Lys-21' and/or 'Lys-22' with a monoubiquitin. Ubiquitin chain elongation is then performed by CDC34, building ubiquitin chains from the UBE2D3-primed NFKBIA-linked ubiquitin. Acts also as an initiator E2, in conjunction with RNF8, for the priming of PCNA. Monoubiquitination of PCNA, and its subsequent polyubiquitination, are essential events in the operation of the DNA damage tolerance (DDT) pathway that is activated after DNA damage caused by UV or chemical agents during S-phase. Associates with the BRCA1/BARD1 E3 ligase complex to perform ubiquitination at DNA damage sites following ionizing radiation leading to DNA repair. Targets DAPK3 for ubiquitination which influences promyelocytic leukemia protein nuclear body (PML-NB) formation in the nucleus. In conjunction with the MDM2 and TOPORS E3 ligases, functions ubiquitination of p53/TP53. Supports NRDP1-mediated ubiquitination and degradation of ERBB3 and of BRUCE which triggers apoptosis. In conjunction with the CBL E3 ligase, targets EGFR for polyubiquitination at the plasma membrane as well as during its internalization and transport on endosomes. In conjunction with the STUB1 E3 quality control E3 ligase, ubiquitinates unfolded proteins to catalyze their immediate destruction.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025356" in other vectors (5)
SKU Description Size Price
MG200987 Ube2d3 (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3) 10 ug
$350.00
MR200987 Ube2d3 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3) 10 ug
$289.00
MR200987L3 Lenti ORF clone of Ube2d3 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3) 10 ug
$450.00
MR200987L4 Lenti ORF clone of Ube2d3 (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3) 10 ug
$450.00
MR200991 Ube2d3 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3) 10 ug
$289.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products