Coprs (NM_025556) Mouse Untagged Clone

SKU
MC203166
Coprs (untagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Coprs
Synonyms 1700029I03Rik; 2410022L05Rik; AA409325; AI256813; C85432; Copr5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC029192
GCGTCCCAGGCGCCTGGCTGTGGGCGGCCGGGCATGGACCCTCAGGCAGCCACCGGTCGGGGCCCGGGCG AGCGGAGTTCGCAGGAGGCCCCCAGCGCGGAGGCTGGCTTTGCCACAGCTGACCTCTCTGGTCGGGAGAC GGAGACTGAGCTGGCCGTGGATCGACTAGCCAGTGGAGCTCAGAGCATCCCTGCTGACATTCCTGCCCAT GCCGAGGGCCCAAGTTCTGAGGAGGAAGGCTTTGCAGTGGAGAAGGAAGCTGATGGGGAGTTGTATGCCT GGGAGCTGTCAGAGGGTCCATCCTGCCCACCCATGGAACAGGCTGCAGATCTTTTTAATGAGGACTGGGA CTTGGAGCTGAAAGCAGACCAAGGAAATCCTTACGATGCTGATGACATCCAGGGGAGCATTTCCCAAGAG ATCAAGCCTTGGGTGTGCTGTGCACCACAGGGAGACATGATATACGACCCCAGTTGGCACCATCCACCTC CACTCATACCACACTACTCCAAGATGGTCTTCGAAACAGGACAGTTTGATGATGCCGAAGACTAGAAGTG TCACTTTCCACAGTGGAGTGGGGGAGTTTTTGTGTCCTCCAGATCACAAGTTGTTTCCTGTGTTTCAAGT GAGATACTCTGTCCGTTCTCAGCGACTCCTCAGTGTGGGCTATAGACAGGCATTAACTGGGGCATGTTGT TGTGGTGGTTGTTGTTAATGGACTCTGGAGTGTGTTGGAATTTTTGTCTGTGTTAGAGTTGTGTTCTTTA TAAATAAAGTTAGGGAAAAATCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_025556
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC029192, AAH29192
RefSeq Size 807 bp
RefSeq ORF 522 bp
Locus ID 66423
UniProt ID Q9CQ13
Cytogenetics 8 A1.1
Summary Histone-binding protein required for histone H4 methyltransferase activity of PRMT5. Specifically required for histone H4 'Arg-3' methylation mediated by PRMT5, but not histone H3 'Arg-8' methylation, suggesting that it modulates the substrate specificity of PRMT5. Specifically interacts with the N-terminus of histone H4 but not with histone H3, suggesting that it acts by promoting the association between histone H4 and PRMT5. Involved in CCNE1 promoter repression (By similarity). Plays a role in muscle cell differentiation by modulating the recruitment of PRMT5 to the promoter of genes involved in the coordination between cell cycle exit and muscle differentiation.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025556" in other vectors (4)
SKU Description Size Price
MG201479 Coprs (tGFP-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) 10 ug
$500.00
MR201479 Coprs (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) 10 ug
$289.00 $300.00
MR201479L3 Lenti ORF clone of Coprs (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) 10 ug
$600.00
MR201479L4 Lenti ORF clone of Coprs (mGFP-tagged) - Mouse RIKEN cDNA 2410022L05 gene (2410022L05Rik) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products