OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Psma2 (NM_008944) Mouse Untagged Clone

Be the first to review this product
SKU
MC203152
Psma2 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Psma2 or NM_008944"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Psma2
Synonyms Lmpc3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC026768
GTAAAGATGGCAGAGCGCGGTTACAGCTTCTCGCTGACTACATTCAGCCCATCTGGTAAGCTTGTCCAGA TTGAATATGCCTTGGCTGCGGTAGCTGGAGGGGCCCCTTCAGTGGGGATTAAAGCTGCAAATGGCGTAGT ATTAGCAACCGAGAAAAAGCAGAAATCCATCCTGTATGATGAAAGGAGTGTTCACAAGGTGGAGCCCATT ACCAAGCACATCGGTTTGGTGTACAGTGGCATGGGCCCCGATTACAGAGTACTTGTACACAGAGCTCGGA AACTTGCTCAGCAATACTACCTTGTTTACCAAGAACCCATTCCCACAGCCCAGCTGGTACAGAGAGTAGC CTCTGTGATGCAGGAGTACACGCAGTCAGGTGGTGTTCGTCCATTTGGTGTTTCTTTACTCATTTGTGGG TGGAATGAGGGACGACCATATTTATTTCAGTCAGATCCATCTGGAGCTTACTTTGCCTGGAAGGCCACAG CAATGGGAAAGAACTATGTGAACGGGAAAACTTTCCTTGAGAAAAGATATAATGAAGACCTAGAGCTGGA GGATGCCATTCATACAGCCATCTTAACCCTAAAGGAAAGCTTTGAAGGGCAGATGACAGAAGATAACATA GAAGTTGGGATCTGCAATGAGGCTGGCTTTAGGAGGCTCACTCCAACTGAAGTGAGGGATTACCTGGCTG CCATAGCGTGATGAAGATGTGCTCACACACTCGACTTTTTCATGTTTAAAGTATGTTTTGTTTGTGCAGA CTTATTTCTACATGGTTTAGTGGATTCACATTTTAAAAATAATCATAATAAACTGTTAAAACCAAAAAAA AAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_008944
Insert Size 705 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC026768, AAH26768
RefSeq Size 848 bp
RefSeq ORF 705 bp
Locus ID 19166
UniProt ID P49722
Cytogenetics 13 A1
Summary Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008944" in other vectors (4)
SKU Description Size Price
MG202835 Psma2 (tGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2) 10 ug
$500.00
MR202835 Psma2 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2) 10 ug
$289.00 $300.00
MR202835L3 Lenti ORF clone of Psma2 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2) 10 ug
$600.00
MR202835L4 Lenti ORF clone of Psma2 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products