Ppp1ca (NM_031868) Mouse Untagged Clone

SKU
MC202914
Ppp1ca (untagged) - Mouse protein phosphatase 1, catalytic subunit, alpha isoform (Ppp1ca), (10ug)
  $450.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ppp1ca
Synonyms dism2; Ppp1c
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC014828 sequence for NM_031868
GGAGGCAGGAGAGGGCCCGGAGCTGGTGGGCCGGAGCGGCGGCGCCGCCATGTCCGACAGCGAGAAGCTC AACCTGGACTCCATCATCGGGCGCCTGCTGGAAGTGCAGGGCTCACGGCCTGGGAAGAACGTGCAGCTGA CAGAGAACGAGATCCGTGGTCTGTGCCTCAAATCCCGGGAGATTTTCCTGAGCCAGCCCATTCTTCTGGA GCTTGAGGCGCCCCTCAAGATCTGTGGTGACATCCATGGCCAGTACTATGACCTTCTACGGCTGTTTGAG TATGGTGGCTTCCCTCCAGAGAGCAACTACCTCTTCTTGGGGGATTATGTAGATCGGGGCAAGCAGTCTT TGGAGACCATCTGCCTGTTGCTGGCCTATAAGATCAGATACCCGGAGAATTTCTTTCTACTTCGTGGGAA CCATGAGTGTGCCAGCATCAACCGCATTTATGGCTTCTATGATGAATGCAAGAGAAGATACAACATCAAA CTGTGGAAGACGTTCACTGACTGCTTCAACTGCCTGCCCATTGCAGCCATTGTGGATGAGAAGATCTTCT GCTGCCACGGGGGCCTGTCTCCAGACTTGCAATCCATGGAGCAGATTAGGCGTATTATGCGGCCCACAGA CGTGCCTGACCAGGGCCTACTGTGTGATCTCCTGTGGTCTGACCCTGACAAGGATGTTCAAGGCTGGGGC GAGAATGACCGTGGTGTCTCCTTTACCTTTGGGGCTGAGGTGGTAGCCAAGTTCCTGCACAAGCATGATT TGGACCTCATCTGCAGAGCACATCAGGTTGTAGAAGATGGCTATGAGTTCTTTGCCAAGAGACAGTTGGT GACACTCTTCTCAGCTCCCAACTACTGTGGAGAGTTTGACAATGCTGGTGCCATGATGAGTGTGGATGAG ACCCTCATGTGTTCCTTCCAGATCCTCAAGCCCGCTGATAAGAATAAGGGCAAGTATGGGCAGTTCAGCG GCCTGAACCCCGGAGGCCGGCCCATCACTCCACCCCGCAATTCTGCCAAAGCCAAGAAATAGCCTCCATG TGCTGCCCTTCTGCCCCAGATCGTTTGTACAGAAATCATGCTGCCATGGGTCACACTGGCCTCTCAGGCC CACCCGTCACGGGGAACACACAGCGTTAAGTGTCTTTCCTTTATTTTTTAAAGAATCAATAGCAGCATCT AATCTCCCAGGGCTCCCTCCCACCAGCACCTGTGGTGGCTGCAAGTGGAATCCTGGGGCCAAGGCTGCAG CTCAGGGCAATGGCAGACCAGATTGTGGGTCTCCAGCCTTGCATGGCTGGCAGCCAGATCCTGGGGCAAC CCATCTGGTCTCTTGAATAAAGGTCAAAGCTGGATTCTCAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_031868
Insert Size 993 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC014828, AAH14828
RefSeq Size 1392 bp
RefSeq ORF 993 bp
Locus ID 19045
UniProt ID P62137
Cytogenetics 19 A
Summary Protein phosphatase that associates with over 200 regulatory proteins to form highly specific holoenzymes which dephosphorylate hundreds of biological targets. Protein phosphatase 1 (PP1) is essential for cell division, and participates in the regulation of glycogen metabolism, muscle contractility and protein synthesis. Involved in regulation of ionic conductances and long-term synaptic plasticity. May play an important role in dephosphorylating substrates such as the postsynaptic density-associated Ca(2+)/calmodulin dependent protein kinase II. Component of the PTW/PP1 phosphatase complex, which plays a role in the control of chromatin structure and cell cycle progression during the transition from mitosis into interphase. Regulates NEK2 function in terms of kinase activity and centrosome number and splitting, both in the presence and absence of radiation-induced DNA damage. Regulator of neural tube and optic fissure closure, and enteric neural crest cell (ENCCs) migration during development. In balance with CSNK1D and CSNK1E, determines the circadian period length, through the regulation of the speed and rhythmicity of PER1 and PER2 phosphorylation. May dephosphorylate CSNK1D and CSNK1E. Dephosphorylates CENPA (By similarity). Dephosphorylates the 'Ser-139' residue of ATG16L1 causing dissociation of ATG12-ATG5-ATG16L1 complex, thereby inhibiting autophagy (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_031868" in other vectors (4)
SKU Description Size Price
MG204856 Ppp1ca (tGFP-tagged) - Mouse protein phosphatase 1, catalytic subunit, alpha isoform (Ppp1ca) 10 ug
$650.00
MR204856 Ppp1ca (Myc-DDK-tagged) - Mouse protein phosphatase 1, catalytic subunit, alpha isoform (Ppp1ca) 10 ug
$450.00
MR204856L3 Lenti ORF clone of Ppp1ca (Myc-DDK-tagged) - Mouse protein phosphatase 1, catalytic subunit, alpha isoform (Ppp1ca) 10 ug
$750.00
MR204856L4 Lenti ORF clone of Ppp1ca (mGFP-tagged) - Mouse protein phosphatase 1, catalytic subunit, alpha isoform (Ppp1ca) 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products