OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Selenow (NM_009156) Mouse Untagged Clone

Be the first to review this product
SKU
MC202669
Sepw1 (untagged) - Mouse selenoprotein W, muscle 1 (Sepw1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
  $242.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Selenow or NM_009156"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Selenow
Synonyms selW; Sep; Sepw1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC052719 sequence for NM_009156
CTTGTTGCTTGTGGGTCGGGTCCTCGTGTTGTGCGGGGATGCGACGTGCAGCTATGGCGCTCGCCGTTCG AGTCGTGTATTGTGGAGCTTGAGGCTATAAGCCCAAGTACCTCCAGCTCAAGGAGAAGCTAGAACATGAG TTCCCCGGATGCCTGGACATTTGTGGCGAGGGGACTCCCCAGGTCACCGGGTTCTTTGAAGTGACAGTAG CCGGGAAGTTGGTCCACTCCAAGAAGAGAGGTGATGGCTATGTGGATACAGAGAGCAAGTTCCGGAAACT GGTGACCGCCATCAAAGCTGCCTTGGCTCAGTGCCAGTGAGCCCTAGAGGCAGGGTCCTGAAAGCTCCTG GCCGGCCTTCCTTGGCAGCCGCTTCATGACAGGAAGGACTGAAATGTCTTAGACCTGTGGTCTTTCCTCG ATGTTCCTGCGGCCACCAAGTCAGGCCAGAGATGGATTCTGGCTGTGGGTGCCTCCCCAGAATCTACCCG TGCACGCAGCCTGCCCTGCCCCCCTGCCCTCTTCCCCACCTCTCTCTCTGAATTCCCCCATTGTTTCCCA CCCACCCTCCTGCTTTGCTTTCCCTTTCCACCTCAAGACTTCAAGAAGACAGGCAGCCATGTTTCCAGGT GTTCCCGGTTGAATAAAGTTTGGATGAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI |
ACCN NM_009156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC052719, AAH52719
RefSeq Size 690 bp
Locus ID 20364
UniProt ID P63300
Cytogenetics 7 A2
Summary This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is highly expressed in skeletal muscle and brain. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, and has been shown to function as a glutathione-dependent antioxidant in vivo. Studies in mouse suggest that this selenoprotein is involved in muscle growth and differentiation, and in the protection of neurons from oxidative stress during neuronal development. provided by RefSeq, Apr 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009156" in other vectors (2)
SKU Description Size Price
MG200204 Sepw1 (GFP-tagged) - Mouse selenoprotein W, muscle 1 (Sepw1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) 10 ug
$318.00
MR200204 Txnrd3 (Myc-DDK-tagged) - Mouse thioredoxin reductase 3 (Txnrd3), transcript variant 1, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) 10 ug
$118.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products