OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Asna1 (NM_019652) Mouse Untagged Clone

Be the first to review this product
SKU
MC202534
Asna1 (untagged) - Mouse arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (Asna1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Asna1 or NM_019652"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Asna1
Synonyms 1810048H22Rik; ArsA
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC083335 sequence for NM_019652
CCGGGTCCAAGATGGCGGCGGGGGTGGCCGGGTGGGGGGTTGAAGCAGAAGAGTTCGAGGATGCACCTGA TGTGGAGCCGCTGGAACCCACGCTTAGCAATATCATCGAGCAGCGTAGCCTTAAGTGGATCTTCGTCGGG GGCAAGGGTGGCGTTGGTAAGACCACCTGCAGCTGCAGCCTGGCAGTCCAGCTGTCGAAGGGACGTGAGA GTGTTCTGATCATTTCCACAGACCCAGCTCACAACATCTCAGATGCTTTTGACCAGAAGTTCTCCAAGGT GCCTACCAAGGTCAAAGGCTATGACAACCTCTTTGCTATGGAGATAGACCCCAGCCTGGGCGTTGCAGAG CTCCCCGACGAGTTCTTCGAGGAAGACAACATGCTGAGCATGGGCAAGAAGATGATGCAGGAGGCCATGA GCGCCTTCCCTGGCATCGATGAAGCCATGAGTTATGCTGAGGTCATGAGGCTGGTGAAAGGCATGAACTT CTCAGTGGTAGTGTTCGACACAGCACCCACCGGCCATACACTCAGGCTCCTGAACTTCCCGACCATCGTG GAGAGGGGCCTGGGCCGCCTGATGCAGATCAAGAACCAGATCAGCCCCTTCATCTCACAGATGTGCAACA TGCTGGGCCTGGGGGACATGAATGCTGACCAACTGGCCTCCAAGCTAGAAGAGACGTTGCCTGTCATCCG ATCTGTTAGCGAACAGTTCAAGGACCCTGAACAGACAACGTTCATCTGTGTGTGCATCGCCGAATTCTTG TCCTTGTACGAGACGGAGCGGCTGATCCAGGAGCTGGCTAAGTGCAAGATCGACACCCACAACATCATCG TCAACCAGCTTGTCTTCCCTGACCCTGAGAAACCCTGCAAGATGTGTGAGGCCCGACACAAGATCCAGGC CAAGTACCTGGACCAGATGGAAGACCTATATGAAGACTTTCACATTGTAAAGCTGCCACTGTTACCTCAC GAGGTTCGGGGAGCCGACAAAGTCAACACCTTCTCTGCCCTCCTCCTGGAGCCCTACAAGCCCCCCAGCA CCCAGTAGCCACCCCCATCCCTGCTGCTGCCTTCATACCCTCCTCTTTCCCCATGGGGCAGAGTTTGCAC AAAGTCCCCCATAATGCAGGGGGCCACTTAGGAGGTGGGAGGGGGTCTGTTCCCCCTGGTGGGGCCTGGG GAGGCTGCAATGCCCCCCACCTCTTCCTGCCTCACACTCCTCAATAAAATAATCTTACACAAAAAAAAAA AAAAAAAAAAAAA
Restriction Sites AscI-NotI |
ACCN NM_019652
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC083335, AAH83335
RefSeq Size 1273 bp
RefSeq ORF 1047 bp
Locus ID 56495
UniProt ID O54984
Cytogenetics 8 C3
Summary ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum. Recognizes and selectively binds the transmembrane domain of TA proteins in the cytosol. This complex then targets to the endoplasmic reticulum by membrane-bound receptors, where the tail-anchored protein is released for insertion. This process is regulated by ATP binding and hydrolysis. ATP binding drives the homodimer towards the closed dimer state, facilitating recognition of newly synthesized TA membrane proteins. ATP hydrolysis is required for insertion. Subsequently, the homodimer reverts towards the open dimer state, lowering its affinity for the membrane-bound receptor, and returning it to the cytosol to initiate a new round of targeting.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019652" in other vectors (4)
SKU Description Size Price
MG205259 Asna1 (tGFP-tagged) - Mouse arsA (bacterial) arsenite transporter, ATP-binding, homolog 1 (Asna1) 10 ug
$657.00
MR205259 Asna1 (Myc-DDK-tagged) - Mouse arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (Asna1) 10 ug
$289.00 $457.00
MR205259L3 Lenti ORF clone of Asna1 (Myc-DDK-tagged) - Mouse arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (Asna1) 10 ug
$757.00
MR205259L4 Lenti ORF clone of Asna1 (mGFP-tagged) - Mouse arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) (Asna1) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products